Presentation is loading. Please wait.

Presentation is loading. Please wait.

Ch. 13: DNA, RNA and Proteins. 12-1: The Structure of DNA  What is genetic material composed of?  What experiments helped to identify the role of DNA?

Similar presentations


Presentation on theme: "Ch. 13: DNA, RNA and Proteins. 12-1: The Structure of DNA  What is genetic material composed of?  What experiments helped to identify the role of DNA?"— Presentation transcript:

1 Ch. 13: DNA, RNA and Proteins

2 12-1: The Structure of DNA  What is genetic material composed of?  What experiments helped to identify the role of DNA?  What is the shape of a DNA molecule?  How is information organized in a DNA molecule?  What scientific investigations led to the discovery of DNA’s structure?

3 Structure of DNA People have historically had an interest in heredity Mendel suggested parents physically gave traits to offspring in early 1800’s Discovered mitosis and meiosis in late 1800’s 1950’s knew chromosomes where made of DNA DNA’s structure (and importance) was discovered in 1953. Human genome work done in 2004.

4 DNA: The Genetic Material DNA is the primary material that causes inherited traits. DNA is a fairly simple chemical compound –DNA stands for deoxyribonucleic acid –It contains ribose sugar, phosphate and 4 ‘bases’ –Chromosomes are made of DNA and protein –DNA codes for how to make proteins –Proteins are responsible for the traits (growth hormone for tallness and antigens for type A blood are both proteins)

5 Discovery of DNA Three experiments suggested and proved that DNA was the molecule that carried information between cells –Fredrick Griffith worked with bacteria in mice (1928) See page 294 Griffith discovered Bacterial Transformation

6 –Oswald Avery worked with bacteria (1940’s) Transformation caused by DNA for specific protein –Alfred Hershey and Martha Chase worked with bacteria and viruses called ‘phages’.(1952)

7 Summary of Experiments Griffith found that –Bacteria can “trade information” and “learn how to make new proteins” Avery found that –It is the DNA that “tells” the bacteria cells how to make the new proteins ( for the capsule that caused the deadly form of bacteria) Hershey and Chase found that –If you trace DNA from a virus it goes into the infected bacteria cells. But the protein from the virus does not enter the infected cell. DNA transmits the information about how to make a protein DNA can move between cells

8 Shape of DNA James Watson and Francis Crick discovered 1953, at Cambridge University Knowing structure allowed them to figure out how it does its job –Code is linear (along the length, “spelled” with 4 bases; ATCG) –It can open up to make copies Shape is called a double helix

9 Part of the DNA strand pg. 296 Back bone of double helix is a sugar (deoxyribose) and phosphate strand –strong covalent bonds. –S (sugar)-P-S-P-S-P….. –P is phosphate; PO 4 -3 Nitrogenous bases make up the ‘rungs’ that hold the ‘backbones’ of the helix together. –Adenine(A), guanine(G), cytosine(C) and thymine (T) –A bonds to T and C bonds to G using Hydrogen bonds –DNA splits open between bases during replication

10 Information on DNA The linear sequence of bases is THE CODE Pattern of ATC and G along the length of the double helix codes for how to make all of the proteins needed to build and to run cells (organisms) One side of the helix is the actual information. The other side is “complementary” - actually it’s the opposite. (A-T and C-G)

11 What Watson and Crick Discovered 1.Pattern Used data from E. Chargaff to build model with A across from T and C across from G 2. Technology M. Wilkins and R. Franklin showed them how to take x- ray crystallography (pictures) of the DNA strand …coils 3. Model built a 3-D model to help decide research/hypothesis and noticed that the model was the answer. 4. Published famous paper in journal called Nature in 1953 5. Received Nobel Prize 1962

12 13-2: Replication of DNA How does DNA replicate or make a copy of itself? What are the roles of proteins in DNA replication? How is DNA replication different in prokaryotes and eukaryotes?

13 DNA Replication A dividing cell makes an exact copy of the DNA information in its nucleus before it divides –Short version (during S portion of Interphase) DNA double helix unzips Right side makes a new left half Left side makes a new right half 2 new, identical, complete copies

14 Semi-conservative Replication *See pic. on pg 301 * know this process * The detailed version 1. Enzymes cause helix to unwind Enzyme called helicase ( all enzymes end in –ase) Split is called replication fork (Y shape) Direction of copying is ‘antiparallel; one strand copies top to bottom, other - from bottom toward top 2. Complementary bases are added to the exposed bases A to T and C to G Bases are available from diet, in the nucleoplasm Spontaneous hydrogen bonds 3. As bases are added helix reseals and twists Enzyme that adds bases is called DNA polymerase 4. Proof reading of DNA occurs using yet another enzyme One mistake per billion nucleotides 5. These enzymes are proteins that were coded for by DNA!

15 Prokaryotes vs. Eukaryotes DNA is packaged into chromosomes –Prokaryotes have 1 –Eukaryotes have many –Regions of chromosomes that code for a protein are called genes Other –Smallest euk. chromo is 10x prok. Chromo –All human chromosome information stretch out = 2 meters –Bacteria would only be 0.25 cm –Human would take 33 days to copy starting at only one point. Prokaryotes –Replication of the one chromosome starts at a single point. Eukaryotes –DNA coiled around protein threads called histones –Replication starts at many points and goes in both directions –Occurs faster; since there’s so much more to copy (only 8 hrs.)

16 DNATranscriptionRNATranslationProtein synthesis Actual directions chemical, found in the nucleus; can not leave Making a copy DNA  RNA Edit to mRNA Copy of the directions, able to go to ribosomes Reading the directions on mRNA to make a protein Finishing protein beyond putting aa together, fold and package Cook book Each recipe is a gene, each family has their own versions Copying recipe to recipe card or emailing to a friend Recipe on recipe card/ email arriving at friends house Following recipe at a friends house, from card or email Not just mixing the cookie dough, but baking/cooling/p utting in bags/etc and doing the dishes Encyclopedia set - that can not leave library; entire wikipedia information Photocopy of one entry Look up “fact” You, taking the photocopy/print out of library/ home You use information from this print out to put together paragraphs for a report The actual finished report that you hand in All the possible soccer plays known The actual route your team decides to use to pass The fact that the players know their positions for the throwing Completing the throw in Adding that throw in to other moves to score a goal

17 Transcription Copying DNA information onto RNA DNA can not leave nucleus Proteins are made at ribosomes, out in the cytoplasm; either free or attached to rER DNA opens and one side is ‘read’ and a copy is made Can make multiple copies, send to lots of ribosomes, make lots of protein at once RNA is edited and the final version, mRNA leaves the nucleus, carrying the message

18 Translation mRNA is ‘decoded’ by the ribosome The right amino acids placed in the right order to make a protein. Code is 300-400 bases long Read in groups of three called codons Codon = ‘piece of code’ This equals 100+ amino acids Right amino acids bonded, using peptide bonds = polypeptide = completed, folded polypeptide = protein. * Everything in your body is a protein or is regulated and controlled by a protein! *

19 Protein synthesis Complete process –Read DNA code –Assemble amino acids in order –Fold and process polypeptide –Have a functional protein –Transcription + Translation + Processing

20 Translate and transcribe the following information into an amino acid sequence GAAAATATCATCTATGGTGGTGTTTAA


Download ppt "Ch. 13: DNA, RNA and Proteins. 12-1: The Structure of DNA  What is genetic material composed of?  What experiments helped to identify the role of DNA?"

Similar presentations


Ads by Google