Presentation is loading. Please wait.

Presentation is loading. Please wait.

Agenda: 11/14 Purpose: To prepare for the UNCC field trip Tools of Genetics: Restriction Enzymes, Recombinant DNA (Genetic Engineering) and Bioinformatics.

Similar presentations


Presentation on theme: "Agenda: 11/14 Purpose: To prepare for the UNCC field trip Tools of Genetics: Restriction Enzymes, Recombinant DNA (Genetic Engineering) and Bioinformatics."— Presentation transcript:

1 Agenda: 11/14 Purpose: To prepare for the UNCC field trip Tools of Genetics: Restriction Enzymes, Recombinant DNA (Genetic Engineering) and Bioinformatics Warm-up: Revise DNA worksheet with team partners Restriction Enzymes: DNA Scissors Cornell notes & complete exercise Video clip - Enzymes (Shape & function) The New Genetics: Tools of Genetics Recombinant DNA (Genetic Engineering) What, why, how Homework:

2 UNCC Field Trip To learn about research being conducted at UNCC, which incorporate biotechnology techniques Leave 8:45 am Bioinformatics and Genetics 9:30 to 10:45 Biology and Biotechnology 11:00 to 12:15 Lunch or snack at the Student Union?? If time

3 DNA With your table partners, determine the best answers for the DNA questions. As a class, we will review any unresolved answers. DNA Replication Process – YouTube

4 DNA replication =related =related DNA packaging - chromosomes DNA Replication – YouTube DNA replication (7 min) dna replication - YouTube

5 DNA Scissors To apply the cutting of restriction enzymes To learn the scientific terms associated with restriction enzymes You will identify the important terms and provide an explanation based on the article (including the questions in the exercises) at least 6 Complete Exercise 1: Carefully read and follow the directions

6 How the restriction enzymes interact with the DNA Structure (shape) and function Restriction Enzymes Videos, NEB p

7 RECOMBINANT DNA = GENETIC ENGINEERING Introduction

8 Tools of Genetics: Recombinant DNA and Cloning Read pp. 38 & 39: The New Genetics Summarize: How do scientists move genes from one organism to another? Explain the role of restriction enzymes Explain how the DNA fragments are combined Explain the role of cloning in the making of insulin

9 Recombinant DNA (rDNA) Method to create a new DNA molecule by piecing together different DNA molecules When cells accept the rDNA, they will “express” the new genes by making the new proteins Cells are “genetically engineered”

10 DNA With your table partners, determine the best answers for the DNA questions. As a class, we will review any unresolved answers.

11 DNA Scissors To apply the cutting of restriction enzymes To learn the scientific terms associated with restriction enzymes You will identify the important terms and provide an explanation based on the article (including the questions in the exercises) at least 6 Complete Exercise 1: Carefully read and follow the directions

12 How the restriction enzymes interact with the DNA Structure (shape) and function Restriction Enzymes Videos, NEB p

13 Introduction HHMI's BioInteractive - Genetic engineering

14 Genetically engineered products- using recombinant DNA (rDNA) Why? Products in the body are either: (1) Made in too small quantities (2) Made at the wrong time (3) Lack an important characteristic (4) Can be made in greater quantity for medical use

15 Uses rDNA – proteins made by body in small quantities Insulin (first rDNA product; 1982) Growth hormone Children with insufficient growth hormone or poor kidney function Blood clot prevention (plasminogen activator) Larger quantities used to prevent heart attacks or strokes Blood clotting factor – for hemophilia Gamma interferon – fight cancer growth

16 Genetic Engineering –Recombinant DNA How? Identify a molecule produced by a living organism Isolate the instructions (DNA sequence = gene) Put the instructions into another cell or organism Allow the cell to replicate Harvest the desired product

17 What do we need to learn about to understand how recombinant DNA products? Genes and proteins Bacteria Copying cells - Mitosis How are enough protein is made? PCR

18 The Vector (E. coli bacteria).

19 Chromosome & Plasmid

20

21 BIOINFORMATICS The use of Computer Computation to Analyze DNA Sequences

22 Bioinformatics Definition: The application of computer science and information technology to biology and medicine. Why is bioinformatics important?

23 Reading & Cornell Notes The New Genetics: Pp Biological Databases Flybase.org FlyBase Homepage GenBank GenBank Sample Record

24 A perspective of data bases Dr. Lander – on the Genome Project (s) HHMI's BioInteractive - Interview with Dr. Eric Lander

25 DNA Barcoding An application of Bioinformatics s/iTEST_DNAbarcoding.swf s/iTEST_DNAbarcoding.swf s/iTEST_DNAbarcoding.swf

26 Reference …TTCACCAACATGCCCACA… F T N M P T Patient …TTCACCAACAGGCCCACA… F T N R P T …TTCACCAACAGGCCCACA… Extract DNA from Cells Sequence DNA Compare Patient DNA Sequence to Reference Sequence Search Database to Determine if Patient Mutation is Associated with Disease Patient Sample: Blood or Saliva Inside the Gene Machine: How Information from DNA is Acquired and Used for Genetic Testing Genetic Counselors work with patients to help them decide whether or not to have a genetic test, and help them understand the results of the test. Lab Technicians work with patient samples in the lab, purifying and sequencing the DNA. Computational Biologists create computer programs to help biologists analyze data. Biomedical Researchers perform experiments with patient samples to find different variations of genes that might cause disease, Medical Doctors and Veterinarians use the knowledge gained from genetic testing to care for their patients.

27 The BRCA1 Gene ATGGATTTATCTGCTCTTCGCGTTGAAGAAGTACAAAATGTCATTAATGCTATGCAGAAAATCTTAGAGTGTCCCATCTGTCTGGAGTTGATCAAGGAACCTGTCTCCACAAAGTGTGACCACATATTTTGCAAATTTTGCATGCTGAAACT TCTCAACCAGAAGAAAGGGCCTTCACAGTGTCCTTTATGTAAGAATGATATAACCAAAAGGAGCCTACAAGAAAGTACGAGATTTAGTCAACTTGTTGAAGAGCTATTGAAAATCATTTGTGCTTTTCAGCTTGACACAGGTTTGGAGTATG CAAACAGCTATAATTTTGCAAAAAAGGAAAATAACTCTCCTGAACATCTAAAAGATGAAGTTTCTATCATCCAAAGTATGGGCTACAGAAACCGTGCCAAAAGACTTCTACAGAGTGAACCCGAAAATCCTTCCTTGCAGGAAACCAGTCTC AGTGTCCAACTCTCTAACCTTGGAACTGTGAGAACTCTGAGGACAAAGCAGCGGATACAACCTCAAAAGACGTCTGTCTACATTGAATTGGGATCTGATTCTTCTGAAGATACCGTTAATAAGGCAACTTATTGCAGTGTGGGAGATCAAGA ATTGTTACAAATCACCCCTCAAGGAACCAGGGATGAAATCAGTTTGGATTCTGCAAAAAAGGCTGCTTGTGAATTTTCTGAGACGGATGTAACAAATACTGAACATCATCAACCCAGTAATAATGATTTGAACACCACTGAGAAGCGTGCAG CTGAGAGGCATCCAGAAAAGTATCAGGGTAGTTCTGTTTCAAACTTGCATGTGGAGCCATGTGGCACAAATACTCATGCCAGCTCATTACAGCATGAGAACAGCAGTTTATTACTCACTAAAGACAGAATGAATGTAGAAAAGGCTGAATTC TGTAATAAAAGCAAACAGCCTGGCTTAGCAAGGAGCCAACATAACAGATGGGCTGGAAGTAAGGAAACATGTAATGATAGGCGGACTCCCAGCACAGAAAAAAAGGTAGATCTGAATGCTGATCCCCTGTGTGAGAGAAAAGAATGGAATAA GCAGAAACTGCCATGCTCAGAGAATCCTAGAGATACTGAAGATGTTCCTTGGATAACACTAAATAGCAGCATTCAGAAAGTTAATGAGTGGTTTTCCAGAAGTGATGAACTGTTAGGTTCTGATGACTCACATGATGGGGAGTCTGAATCAA ATGCCAAAGTAGCTGATGTATTGGACGTTCTAAATGAGGTAGATGAATATTCTGGTTCTTCAGAGAAAATAGACTTACTGGCCAGTGATCCTCATGAGGCTTTAATATGTAAAAGTGAAAGAGTTCACTCCAAATCAGTAGAGAGTAATATT GAAGACAAAATATTTGGGAAAACCTATCGGAAGAAGGCAAGCCTCCCCAACTTAAGCCATGTAACTGAAAATCTAATTATAGGAGCATTTGTTACTGAGCCACAGATAATACAAGAGCGTCCCCTCACAAATAAATTAAAGCGTAAAAGGAG ACCTACATCAGGCCTTCATCCTGAGGATTTTATCAAGAAAGCAGATTTGGCAGTTCAAAAGACTCCTGAAATGATAAATCAGGGAACTAACCAAACGGAGCAGAATGGTCAAGTGATGAATATTACTAATAGTGGTCATGAGAATAAAACAA AAGGTGATTCTATTCAGAATGAGAAAAATCCTAACCCAATAGAATCACTCGAAAAAGAATCTGCTTTCAAAACGAAAGCTGAACCTATAAGCAGCAGTATAAGCAATATGGAACTCGAATTAAATATCCACAATTCAAAAGCACCTAAAAAG AATAGGCTGAGGAGGAAGTCTTCTACCAGGCATATTCATGCGCTTGAACTAGTAGTCAGTAGAAATCTAAGCCCACCTAATTGTACTGAATTGCAAATTGATAGTTGTTCTAGCAGTGAAGAGATAAAGAAAAAAAAGTACAACCAAATGCC AGTCAGGCACAGCAGAAACCTACAACTCATGGAAGGTAAAGAACCTGCAACTGGAGCCAAGAAGAGTAACAAGCCAAATGAACAGACAAGTAAAAGACATGACAGCGATACTTTCCCAGAGCTGAAGTTAACAAATGCACCTGGTTCTTTTA CTAAGTGTTCAAATACCAGTGAACTTAAAGAATTTGTCAATCCTAGCCTTCCAAGAGAAGAAAAAGAAGAGAAACTAGAAACAGTTAAAGTGTCTAATAATGCTGAAGACCCCAAAGATCTCATGTTAAGTGGAGAAAGGGTTTTGCAAACT GAAAGATCTGTAGAGAGTAGCAGTATTTCATTGGTACCTGGTACTGATTATGGCACTCAGGAAAGTATCTCGTTACTGGAAGTTAGCACTCTAGGGAAGGCAAAAACAGAACCAAATAAATGTGTGAGTCAGTGTGCAGCATTTGAAAACCC CAAGGGACTAATTCATGGTTGTTCCAAAGATAATAGAAATGACACAGAAGGCTTTAAGTATCCATTGGGACATGAAGTTAACCACAGTCGGGAAACAAGCATAGAAATGGAAGAAAGTGAACTTGATGCTCAGTATTTGCAGAATACATTCA AGGTTTCAAAGCGCCAGTCATTTGCTCCGTTTTCAAATCCAGGAAATGCAGAAGAGGAATGTGCAACATTCTCTGCCCACTCTGGGTCCTTAAAGAAACAAAGTCCAAAAGTCACTTTTGAATGTGAACAAAAGGAAGAAAATCAAGGAAAG AATGAGTCTAATATCAAGCCTGTACAGACAGTTAATATCACTGCAGGCTTTCCTGTGGTTGGTCAGAAAGATAAGCCAGTTGATAATGCCAAATGTAGTATCAAAGGAGGCTCTAGGTTTTGTCTATCATCTCAGTTCAGAGGCAACGAAAC TGGACTCATTACTCCAAATAAACATGGACTTTTACAAAACCCATATCGTATACCACCACTTTTTCCCATCAAGTCATTTGTTAAAACTAAATGTAAGAAAAATCTGCTAGAGGAAAACTTTGAGGAACATTCAATGTCACCTGAAAGAGAAA TGGGAAATGAGAACATTCCAAGTACAGTGAGCACAATTAGCCGTAATAACATTAGAGAAAATGTTTTTAAAGAAGCCAGCTCAAGCAATATTAATGAAGTAGGTTCCAGTACTAATGAAGTGGGCTCCAGTATTAATGAAATAGGTTCCAGT GATGAAAACATTCAAGCAGAACTAGGTAGAAACAGAGGGCCAAAATTGAATGCTATGCTTAGATTAGGGGTTTTGCAACCTGAGGTCTATAAACAAAGTCTTCCTGGAAGTAATTGTAAGCATCCTGAAATAAAAAAGCAAGAATATGAAGA AGTAGTTCAGACTGTTAATACAGATTTCTCTCCATATCTGATTTCAGATAACTTAGAACAGCCTATGGGAAGTAGTCATGCATCTCAGGTTTGTTCTGAGACACCTGATGACCTGTTAGATGATGGTGAAATAAAGGAAGATACTAGTTTTG CTGAAAATGACATTAAGGAAAGTTCTGCTGTTTTTAGCAAAAGCGTCCAGAAAGGAGAGCTTAGCAGGAGTCCTAGCCCTTTCACCCATACACATTTGGCTCAGGGTTACCGAAGAGGGGCCAAGAAATTAGAGTCCTCAGAAGAGAACTTA TCTAGTGAGGATGAAGAGCTTCCCTGCTTCCAACACTTGTTATTTGGTAAAGTAAACAATATACCTTCTCAGTCTACTAGGCATAGCACCGTTGCTACCGAGTGTCTGTCTAAGAACACAGAGGAGAATTTATTATCATTGAAGAATAGCTT AAATGACTGCAGTAACCAGGTAATATTGGCAAAGGCATCTCAGGAACATCACCTTAGTGAGGAAACAAAATGTTCTGCTAGCTTGTTTTCTTCACAGTGCAGTGAATTGGAAGACTTGACTGCAAATACAAACACCCAGGATCCTTTCTTGA TTGGTTCTTCCAAACAAATGAGGCATCAGTCTGAAAGCCAGGGAGTTGGTCTGAGTGACAAGGAATTGGTTTCAGATGATGAAGAAAGAGGAACGGGCTTGGAAGAAAATAATCAAGAAGAGCAAAGCATGGATTCAAACTTAGGTGAAGCA GCATCTGGGTGTGAGAGTGAAACAAGCGTCTCTGAAGACTGCTCAGGGCTATCCTCTCAGAGTGACATTTTAACCACTCAGCAGAGGGATACCATGCAACATAACCTGATAAAGCTCCAGCAGGAAATGGCTGAACTAGAAGCTGTGTTAGA ACAGCATGGGAGCCAGCCTTCTAACAGCTACCCTTCCATCATAAGTGACTCTTCTGCCCTTGAGGACCTGCGAAATCCAGAACAAAGCACATCAGAAAAAGCAGTATTAACTTCACAGAAAAGTAGTGAATACCCTATAAGCCAGAATCCAG AAGGCCTTTCTGCTGACAAGTTTGAGGTGTCTGCAGATAGTTCTACCAGTAAAAATAAAGAACCAGGAGTGGAAAGGTCATCCCCTTCTAAATGCCCATCATTAGATGATAGGTGGTACATGCACAGTTGCTCTGGGAGTCTTCAGAATAGA AACTACCCATCTCAAGAGGAGCTCATTAAGGTTGTTGATGTGGAGGAGCAACAGCTGGAAGAGTCTGGGCCACACGATTTGACGGAAACATCTTACTTGCCAAGGCAAGATCTAGAGGGAACCCCTTACCTGGAATCTGGAATCAGCCTCTT CTCTGATGACCCTGAATCTGATCCTTCTGAAGACAGAGCCCCAGAGTCAGCTCGTGTTGGCAACATACCATCTTCAACCTCTGCATTGAAAGTTCCCCAATTGAAAGTTGCAGAATCTGCCCAGAGTCCAGCTGCTGCTCATACTACTGATA CTGCTGGGTATAATGCAATGGAAGAAAGTGTGAGCAGGGAGAAGCCAGAATTGACAGCTTCAACAGAAAGGGTCAACAAAAGAATGTCCATGGTGGTGTCTGGCCTGACCCCAGAAGAATTTATGCTCGTGTACAAGTTTGCCAGAAAACAC CACATCACTTTAACTAATCTAATTACTGAAGAGACTACTCATGTTGTTATGAAAACAGATGCTGAGTTTGTGTGTGAACGGACACTGAAATATTTTCTAGGAATTGCGGGAGGAAAATGGGTAGTTAGCTATTTCTGGGTGACCCAGTCTAT TAAAGAAAGAAAAATGCTGAATGAGCATGATTTTGAAGTCAGAGGAGATGTGGTCAATGGAAGAAACCACCAAGGTCCAAAGCGAGCAAGAGAATCCCAGGACAGAAAGATCTTCAGGGGGCTAGAAATCTGTTGCTATGGGCCCTTCACCA ACATGCCCACAGATCAACTGGAATGGATGGTACAGCTGTGTGGTGCTTCTGTGGTGAAGGAGCTTTCATCATTCACCCTTGGCACAGGTGTCCACCCAATTGTGGTTGTGCAGCCAGATGCCTGGACAGAGGACAATGGCTTCCATGCAATT GGGCAGATGTGTGAGGCACCTGTGGTGACCCGAGAGTGGGTGTTGGACAGTGTAGCACTCTACCAGTGCCAGGAGCTGGACACCTACCTGATACCCCAGATCCCCCACAGCCACTACTGA


Download ppt "Agenda: 11/14 Purpose: To prepare for the UNCC field trip Tools of Genetics: Restriction Enzymes, Recombinant DNA (Genetic Engineering) and Bioinformatics."

Similar presentations


Ads by Google