Presentation is loading. Please wait.

Presentation is loading. Please wait.

2 주차 Molecular and Biological Chemistry 2. Reading frame Frame 모든 진핵생물은 + strand 에만 정보 갖고 있음 원핵생물은 – strand 에도 정보를 갖고 있지만 +strand 와 서로 겹치지 않음 Virus 는.

Similar presentations


Presentation on theme: "2 주차 Molecular and Biological Chemistry 2. Reading frame Frame 모든 진핵생물은 + strand 에만 정보 갖고 있음 원핵생물은 – strand 에도 정보를 갖고 있지만 +strand 와 서로 겹치지 않음 Virus 는."— Presentation transcript:

1 2 주차 Molecular and Biological Chemistry 2

2 Reading frame Frame 모든 진핵생물은 + strand 에만 정보 갖고 있음 원핵생물은 – strand 에도 정보를 갖고 있지만 +strand 와 서로 겹치지 않음 Virus 는 +, - 모두를 사용하며, 사용구역이 겹치기도 하고, 다른 frame 을 사용하 기도 함.

3 Amborella (eukaryotes) uses only + strand without overlap!

4 Magnolia kobus DC. chloroplastgenome159,245bp Magnolia chloroplast uses + and – strand without overlap

5 Cyanobacterium also uses both strand without overlap Cyanobacterium complete genome

6 Herpes simplex virus DNA virus uses both strand and multiple frame!!!

7 Ethidiumbromide (EtBr): reagent used for DNA detection. It causes frame shift mutation (carcinogen)! Frame shift mutation

8 Polymerase Chain Reaction (PCR) A technique for the in vitro amplification of specific DNA sequences by the simultaneous primer extension of complementary strands of DNA (>10 5 ). PCR method was devised and named by Mullis and colleagues at the Cetus Corporation (Mullis and Faloona, 1987) The principle had been described in detail by Khorana et al. (Kleppe et al., 1971) over a decade earlier. Kary Mullis received the Novel prize (1993). PCR

9 3) DNA POLYMERASE GTTTTCCAAGGG 2) PRIMER 3’3’ 5’5’ ACTACGTACGTACGTGTCCTACGGTTCTTCTTAGTTGTACCACAGTACTCGTACTCGTACTAAA 1) TEMPLETE 3’3’ 5’5’ … 4) dNTP ’ s pool G C A T dATP dCTP dGTP dTTP 5) Mg ++ G CA T A A A A C C C C G T G T G TG T DNA polymerization: DNA polymerase extends a primer by using a complementary strand as a template.

10 Schematic diagram of PCR …… Denature 94 ℃ 3’3’ 5’5’ 5’5’ …… 3’3’ 3’3’ 5’5’ 5’5’ … … … … Anneal primers ca. 50 ℃ 5’5’ 3’3’ 3’3’ 5’5’ … 3’3’ Genomic DNA … 5’5’ 3’3’ …… … 5’5’ 3’3’ … 3’3’ 5’5’ … 5’5’ 3’3’ … 3’3’ 5’5’ … Synthesize New strand 72 ℃ … 3’3’ 5’5’ 5’5’ … … … … 5’5’ 3’3’ 3’3’ 5’5’ … 5’5’ 3’3’ Anneal primers ca. 50 ℃ 5’5’ … 3’3’ 5’5’ 5’5’ 3’3’ 5’5’ 3’3’ 3’3’ 5’5’ 5’5’ Synthesize New strand 72 ℃ 3’3’ 5’5’ … 3’3’ … 5’5’ 3’3’ … … 5’5’ 3’3’ 3’3’ 5’5’ … … 5’5’ … 3’3’ … 3’3’ 5’5’ 3’3’ 5’5’ …… 5’5’ …… 3’3’ 3’3’ 5’5’ … 5’5’ 3’3’ Denature 94 ℃ …

11 … … … … … … … … Denature 94 ℃ … … … … … … … … Anneal primers ca. 50 ℃ … … … … … … … … … … Synthesize New strand 72 ℃ …

12

13

14 심해 열수구 (hydrothermal vents)

15 Taq. DNA Polymerase: Most commonly used DNA polymerase for PCR Isolated from Thermus aquaticus Heat stable polymerase PCR technique put to practical use by finding of Taq. The use of a heat stable enzyme has two major advantages: 1) replenishment after each heating step is not required, thus simplifying the process 2) the enzyme is active at high temperatures, where annealing of the oligonucleotide primers is more specific and DNA synthesis more rapid.

16 Thermophilic DNA polymerases Thermophilic DNA polymerases Thermus aquaticus (Taq) Thermus thermophilus (Tth) Bacillus stearothermophilus (Bst) Pyrococcus furiosis (Pfu)

17 Reaction components 1)Thermophilic DNA polymerases Thermus aquaticus (Taq) Thermus thermophilus (Tth) Bacillus stearothermophilus (Bst) Pyrococcus furiosis (Pfu) Genetically modified for improving proof reading function (3 ’ to 5 ’ exonuclease function) and for hot start PCR.

18 TA cloning

19 Reaction components 1)Thermophilic DNA polymerases Thermus aquaticus (Taq) Thermus thermophilus (Tth) Bacillus stearothermophilus (Bst) Pyrococcus furiosis (Pfu) Genetically modified for improving proof reading function (3 ’ to 5 ’ exonuclease function) and for hot start PCR.

20 Final-extend 72 ℃ An example of a PCR method Temp. ℃ 100 Hold program Pre-denature 95 ℃ Anneal 55 ℃ Extend 72 ℃ Cycle program Hold program Cycle 1 Cycle 2 Cycle 30 Denature 95 ℃ Soak 4 ℃

21 Reaction components 2)Deoxynucleotide Triphosphates Low dNTP concentrations minimize mispriming at nontarget sites and reduce the likelihood of extending misincorporated nucleotides (Innis et al. 1988)

22 Reaction components 3)Primers Generally, use over 18 nucleotides Genome size of higher plants: 5X X10 9 Check list for primer design: 1) Similar Tm values are recommended for two primers 2) Avoid self-complement sequences 3) Avoid primer dimer formation Probability of presence of same nucleotide sequences 6 mer 1/4 6 = 1 / 4X mer 1/4 9 = 1 / 2.6X mer1/4 12 = 1 / 1.7X mer1/4 15 = 1 / 1.1X mer1/4 18 = 1 / 6.9X mer1/4 21 = 1 / 4.4X10 12 Q: 왜 PCR 을 할 때 사용하는 primer 는 주로 18bp 이상을 사용해야 할까 ?

23

24

25

26

27 프라이머디자인사이트 

28 Primer order 의 예

29 Reaction components 4)Reaction buffer Mainly modified from Saiki et al. (1988) Low conc. of Mg ++ : reaction failed High conc. of Mg ++ : mis-pairing pseudo bands Components of PCR buffer Saiki et al. (1988): Suh lab: Tris pH 8.410mM20mM KCl 50mM50mM MgCl2 1.5mM1.5mM gelatin0.01% - NP400.01% - Tween %0.001%

30 Reaction components 5)Template DNA General amount of template DNA: target molecules 1 ug of human DNA 10 ng of yeast DNA ≒ 3X10 5 molecules of single copy gene 1 ng of E.coli DNA Quantification of extracted DNA: 1) spectrophotometer: OD 260 2) spot test in agarose gel

31 UV-spec vs. Nanodrop An A 260 of 1.0 = 50 mg/ml concentration of DNA.

32 Gel electrophoresis 침강제 +Dye+DNA

33 An Example of band (spot) test Marker: PCR Marker (Promega G3161) - Marker concentration: 5 ul contains ng of each DNA fragments - Sample DNA concentration: 6-8 ng/ul ∴ dilute to 1/10  use 2 ul of DNA for 100ul reaction ( ng)

34 Thermal condition and cycle number e.g. PCR amplification of ndhF gene in Magnoliaceae (Kim et al., 2001) Pre-denaturation: 95 ℃ 10 min (  AmpliTaq. Gold) Denaturation: 95 ℃ 1 min Primer annealing:55 ℃ 1 min 30 cycles Primer extension: 72 ℃ 1 min Final extension: 72 ℃ 7 min PCR 온도 조건의 예

35 Final-extend 72 ℃ An example of a PCR method Temp. ℃ 100 Hold program Pre-denature 95 ℃ Anneal 55 ℃ Extend 72 ℃ Cycle program Hold program Cycle 1 Cycle 2 Cycle 30 Denature 95 ℃ Soak 4 ℃

36

37 Depending on reaction conditions and thermal cycling, one or more of the following may influence plateau: 1) Utilization of substrates (dNTPs or primers) 2) Stability of reactants (dNTPs or enzymes) 3) End-product inhibition (pyrophosphate, duplex DNA) …

38 Non-PCR amplification Cloning - PCR product 가 heterogenous 할 때 각 각의 염기서열을 결정하려면 cloning 이 필 요함. RCA (Rolling circle amplificaion)

39 Cloning

40

41 RCA (Rolling circle amplificaion) used for small amount of template such as DNA in herbarium sheets or even fossils.

42 Krause et al Multiplification of the mammoth mitochondial genome and the evolution of Elephantidae. Nature 439: Poinar et al Metagenomics to paleogenomics: large-scale sequencing of mammoth DNA. Science 311:

43 1993 최신 DNA 추출기술과 PCR 기술의 발전은 DNA 가 매우 적게 남아 있는 화석에서 DNA 염기서열 결정을 가능하게 함

44

45

46

47 Magnolia latahensis (Berry) Brown


Download ppt "2 주차 Molecular and Biological Chemistry 2. Reading frame Frame 모든 진핵생물은 + strand 에만 정보 갖고 있음 원핵생물은 – strand 에도 정보를 갖고 있지만 +strand 와 서로 겹치지 않음 Virus 는."

Similar presentations


Ads by Google