Presentation is loading. Please wait.

Presentation is loading. Please wait.

PCR-SSCP Technique Protocols and “Demonstration” Christoph C. Tebbe Institut für Agrarökologie (Dept. Agroecology) Bundesforschungsanstalt für Landwirtschaft.

Similar presentations


Presentation on theme: "PCR-SSCP Technique Protocols and “Demonstration” Christoph C. Tebbe Institut für Agrarökologie (Dept. Agroecology) Bundesforschungsanstalt für Landwirtschaft."— Presentation transcript:

1 PCR-SSCP Technique Protocols and “Demonstration” Christoph C. Tebbe Institut für Agrarökologie (Dept. Agroecology) Bundesforschungsanstalt für Landwirtschaft (FAL) Braunschweig - Germany

2 The SSCP-Side of Life, Part 2 SSCP papers of interest Protocols and Pictures

3 Basic Information Invention of SSCP Orita, M., H. Iwahana, H. Kanazawa, K. Hayashi, and T. Sekyia Detection of polymorphisms of human DNA by gel electrophoresis as single-strand conformation polymorphisms. Proc. Nat. Acad. Sci. USA 86: First description of PCR-SSCP Hayashi, K PCR-SSCP: a simple and sensitive method for detection of mutations in the genomic DNA. PCR Methods Appl. 1:34-38 Differentiation of pure culture bacteria by 16S rRNA targeted PCR-SSCP Widjojoatmodjo, M., A. C. Fluit, J. Verhoef Rapid identification of bacteria by PCR-single strand conformation polymorphism. J. Clinic. Microbiol. 32:

4 more References Automation of PCR-SSCP product analysis for bacterial identification using the ABI machine Widjojoatmodjo, M. C., A. C. Fluit, and J. Verhoef Molecular identification of bacteria by fluorescence-based PCR-single-strand-conformation polymorphism of the 16S rRNA gene. J. Clinic. Microbiol. 33: Use of PCR-SSCP for ITS analysis for identification of fungi (pure cultures) and suggested for community analysis Simon, L., R. C. Levesque, and M. Lalonde Identification of endomycorrhizal fungi colonizing roots by fluorescent single-strand conformation polymorphism-PCR. Appl. Environ. Microbiol. 59: Kumeda, Y., and T. Asao Single-strand conformation polymorphism analysis of PCR-amplified ribosomal DNA internal transcribed spacers to differentiate species of Aspergillus section flavi. Appl. Environ. Microbiol. 62: Clapp, J. P The identification of root-associated fungi by PCR-SSCP, p In A. D. Akkermans, J. D. van Elsas, and F. J. de Bruijn, Molecular Microbial Ecology Manual, Kluwer Academic Publ., Dordrecht, The Netherlands.

5 References (community analysis) First attempt to use SSCP for genetic profiling of microbial communities Lee, D.-H., Y.-G. Zo, and S.-J. Kim Non-radioactive method to study genetic profiles of bacterial communities by PCR-single-strand-conformation polymorphism. Appl. Environ. Microbiol. 62: Bacterial community analysis of bioreactor studies and automated SSCP with product identification by co-migrations Zumstein, E., R. Moletta, and J. J. Gordon Examination of two years of community dynamics in an anaerobic bioreactor using fluorescence polymerase chain reaction single-strand-conformation-polymorphism analysis. Environ. Microbiol. 2:69- 78

6 The “Single-Stranded Community Approach” Strategy, efficiency of the method, patterns of pure culture, mixed model communities and rhizospheres Schwieger, F. and C. C. Tebbe A new approach to utilize PCR-single-strand- conformation polymorphism for 16S rRNA gene-based microbial community analysis. Appl. Environ. Microbiol. 64: Application for monitoring compost MCs, different primers for different taxonomic groups, isolation and sequencing of single bands from profiles Peters, S., S. Koschinsky, F. Schwieger, and C. C. Tebbe Succession of microbial communities during hot composting as detected by PCR-SSCP-based genetic profiles of small- subunit rRNA genes. Appl. Environ. Microbiol. 66: Comparison of PCR-SSCP for MCs with diversity of cultivated bacterial isolates Schwieger, F. and C. C. Tebbe Effect of field inoculation with Sinorhizobium meliloti...- Linking 16S rRNA gene based SSCP community profiles to the diversity of cultivated isolates. Appl. Environ. Microbiol. 66: August issue.

7 Pathway of MC Analysis by PCR-SSCP Extraction and purification of environmental DNA PCR and generation of single-stranded PCR products for SSCP Generation of SSCP profiles pouring of gel - running electrophoresis - staining procedure Isolation and identification of products from SSCP-profiles cloning and sequencing

8 Critical Factors for MC Analysis by PCR-SSCP Extraction and purification of nucleic acids from environmental samples PCR conditions, additives (e.g. T4GP32) Targeted gene fragments, e.g. which variable region? Denaturing procedure Concentrations and cross-linking of polyacrylamide gels, gel length, temperature Additives in the gel (MDE?) glycerol, formamide Staining procedure.....

9 Analysis and interpretation of SSCP profiles Pattern Analysis scanning of whole gels, recording on line, e.g. by ABI machine - digital image analysis, transformation of data, algorithm of pattern comparisons, e.g., Pearson, Dice,... (GelCompar, WinCam,...) - Cross-Gel comparisons!!! Identification of Single Components (Band i.d.) Isolations (crush and soak), reamplification, product check by SSCP with regenerated opposite strand, direct sequencing or cloning in E. coli etc. (non-16S primers)

10 PCR and generation of single-stranded PCR products PCR-amplify target from environmental DNA (dilution, + T4GP32 1 ) - size 300 to 500 bp - one phosphorylated and one non-posphorylated primer Purify product (Qiaquick 2 ) Digest with lambda exonuclease (USB, NEB) of purified PCR product; 10 U at 37°C for 1 h Purify by phenol-chloroform extraction or Qiaquick final volume should not be above 20 (  l) 1, according to Tebbe and Vahjen, 1993, Appl. Environ. Microbiol. 59: ; 2, Qiagen, Hilden, Germany

11 Generation of SSCP-patterns Macrophor System (Pharmacia) MDE (0.6-fold; corresp. to approx. 7 % polyacryl amide; FMC BioWhittaker), no glycerol etc. cast on thermostatic plate treated with repel silane, cover plate with bind silane - spacer 0.4 mm, fixed with clamps MDE in 1 x TBE, filtrate and degas add TEMED and APS for polymerisation cast gel, add comb 2 h at room temperature

12 Generation of SSCP patterns (cont.) insert gel into chamber, add running buffer (TBE) in buffer chambers, activate cooling system at, e.g., 18°C instead of glass plates, GelBond PAG membranes can also be used mix DNA samples with one vol of loading buffer (95 % formamide, 10 mM NaOH, % bromophenol blue and xylene cyanole, resp.. Heat to 95°C for 2 min, immediately chill on ice for 3 min - load up to 8 μl into a sample well

13 Addition of formamide increases the quality of the profiles by preventing non- specific annealing of DNA run gels: longer gels at 750 to 800 V for 18 to 24 h, shorter gels at 400 V for 14 to 16 h keep temperature at 20°C remove spacers and comb, carefully detach cover glass plate start staining procedure... Generation of SSCP patterns (cont.)

14 Staining: Silver staining procedure by Bassam et al. 1 - stick to the protocol (very critical) use trays made of stainless steel - use shaking table freshly prepared: silver nitrate foraldehyde (ss) sodium bicarbonate- formaldehyde-thiosulfate (ds) at 8°C!; acetic acid (stop solution) wash with distilled water - control developer process and stop at the right moment (e.g., 5-10 min) 1, Anal. Biochem. 196:80-83 (1991); detection limit 15 pg ds DNA per band Generation of SSCP patterns (cont.)

15 Drying under the hood Gel on the light table

16 Isolation and Identification of Bands it even works with olde gels (> 0.5 years under the hood) dried gels are rehydrated with A. dest. for 2 to 5 min cut out selected bands with a razor blade - transer to a microfuge tube - crush and soak (Sambrook et al., 1989) reamplify with same primers by PCR, purify with Qiaquick, check on SSCP next to a community profile. Products which match with the intended bands can then be sequenced

17 Cloning and Sequencing purified PCR products are ligated into pGEM-T, transformed into E. coli JM109, clones selected via blue white selection, subcultivation etc. selected bacterial cells are transferred into lysis solution, and PCR amplified with vector specific primers (complementary for forward and 174 to 193 for reverse) PCR products are purified with Qiaquick and sequenced with SequiTherm EXCEL II DNA Sequencing kit (Epicentre) - analyzed on Li-Cor AGAAAAGAAAagTGAAGGCACggAAAATAaAAGGAATTGACGGtAACCCA AAGGAATTGACGGAAACTTAAAGGAATTgACGGAAAcTCAAAGGAGTTGA CGGAAACTCAAAGGAATTGACGGAAACTCAAAGGAATTGACGGAATCACT AGTGCGGCCGCCTGCAGGtCGACCATATGGGAGAGCTcMCAACGCGTTGG ATGCATABTTGAGTATTCTATAGTGTCACCTAAATAGCTTGGCGTAATcA Tgg GGAGCTCtCCCATAtGGTCGACCKGCAGGCGGCCGCACTAGtGATT CCGTCAATTCCTTTGAGTTTCCGTCAATTCCTTTGAGTTTCCGTcAACTC CTTTGAGTTTCCGTCAATTCCTTTAAGTTTCCGTCAATTCCTTTGGGTTT CCGTCAATTCCTTTGAGTTTCCGTCAATTCCTTTGAGTTTCTGCTGCCTC cCCGCGGCCATGGCGGCgcGGGAGCATgCGACGTcGGGCCCAATTcGCCC TATAGTGAGTTCGTATTACAATTCAC GGAGCTCtCCCATAtGGTCGACC CAATTCCTTTGAGTTTCCGTCAATTCCTTTGAGTTTCCGTcAACTCCTTT GAGTTTCCGTCAATTCCTTTAAGTTTCCGTCAATTCCTTTGGGTTTCCGT CAATTCCTTTGAGTTTCCGTCAATTCCTTTGAGTTTCTGCTGCCTCCaaT cCCGCGGCCATGGCGGCgcGGGAGCATgCGACGTcGGGCCCAATTcGCCC TATAGTGAGTTCGTATTACAATTCACAGAAAAGAAAagTGAAGGCACggA AAGGAATTGACGGAAACTTAAAGGAATTgACGGAAAcTCAAAGGAGTTGA CGGAAACTCAAAGGAATTGACGGAAACTCAAAGGAATTGACGGAATCACT AGTGCGGCCGCCTGCAGGtCGACCATATGGGAGAGCTcMCAACGCGTTGG ATGCATABTTGAGTATTCTATAGTGTCACCTAAATAGCTTGGCGTAATcA Tgg GGAGCTCtCCCATAtGGTCGACCKGCAGGCGGCCGCACTAGtGATT CAATTCCTTTGAGTTTCCGTCAATTCCTTTGAGTTTCCGTcAACTCCTTT GAGTTTCCGTCAATTCCTTTAAGTTTCCGTCAATTCCTTTGGGTTTCCGT CAATTCCTTTGAGTTTCCGTCAATTCCTTTGAGTTTCTGCTGCCTCCaaT CAATTCCTTTGAGTTTCCGTCAATTCCTTTGAGTTTCCGTcAACTCCTTT GAGTTTCCGTCAATTCCTTTAAGTTTCCGTCAATTCCTTTGGGTTTCCGT CAATTCCTTTGAGTTTCCGTCAATTCCTTTGAGTTTCTGCTGCCTCCaaT cCCGCGGCCATGGCGGCgcGGGAGCATgCGACGTcGGGCCCAATTcGCCC TATAGTGAGTTCGTATTACAATTCAC GGAGCTCtCCCATAtGGTCGACC CAATTCCTTTGAGTTTCCGTCAATTCCTTTGAGTTTCCGTcAACTCCTTT GAGTTTCCGTCAATTCCTTTAAGTTTCCGTCAATTCCTTTGGGTTTCCGT CAATTCCTTTGAGTTTCCGTCAATTCCTTTGAGTTTCTGCTGCCTCCaaT cCCGCGGCCATGGCGGCgcGGGAGCATgCGACGTcGGGCCCAATTcGCCC TATAGTGAGTTCGTATTACAATTCACAGAAAAGAAAagTGAAGGCACggA AAGGAATTGACGGAAACTTAAAGGAATTgACGGAAAcTCAAAGGAGTTGA CGGAAACTCAAAGGAATTGACGGAAACTCAAAGGAATTGACGGAATCACT AGTGCGGCCGCCTGCAGGtCGACCATATGGGAGAGCTcMCAACGCGTTGG ATGCATABTTGAGTATTCTATAGTGTCACCTAAATAGCTTGGCGTAATcA

18 ... and what happened to that marine community DNA from Nick Fuller and Dave Scanlan? V4/V5 region (Com primers)


Download ppt "PCR-SSCP Technique Protocols and “Demonstration” Christoph C. Tebbe Institut für Agrarökologie (Dept. Agroecology) Bundesforschungsanstalt für Landwirtschaft."

Similar presentations


Ads by Google