Presentation is loading. Please wait.

Presentation is loading. Please wait.

Time Series Data Mining Group Intelligent Icons: Integrating Lite-Weight Data Mining and Visualization into GUI Operating Systems Eamonn Keogh Li Wei Xiaopeng.

Similar presentations


Presentation on theme: "Time Series Data Mining Group Intelligent Icons: Integrating Lite-Weight Data Mining and Visualization into GUI Operating Systems Eamonn Keogh Li Wei Xiaopeng."— Presentation transcript:

1 Time Series Data Mining Group Intelligent Icons: Integrating Lite-Weight Data Mining and Visualization into GUI Operating Systems Eamonn Keogh Li Wei Xiaopeng Xi Stefano Lonardi Jin Shieh Scott Sirowy Computer Science & Engineering Dept. University of California – Riverside

2 Time Series Data Mining Group Outline Overview An Example: DNA to Intelligent Icon Icon Generation Algorithm Experimental Evaluation Conclusion Eamonn, patent this idea! Christos Faloutsos

3 Time Series Data Mining Group Icons in a traditional browser Dataset Kalpakis_ECG

4 Time Series Data Mining Group normal1.txtnormal10.txtnormal11.txt normal12.txt normal13.txtnormal2.txt normal3.txtnormal4.txt normal5.txt normal6.txt normal7.txt normal8.txt normal9.txt normal14.txtnormal15.txt normal16.txt normal17.txt normal18.txt Dataset Kalpakis_ECG Suppose I magically.. 1)Color the icons to somehow reflect the contents of the file. 2)Position the icons based on their colors/patterns

5 Time Series Data Mining Group TGGCCGTGCTAGGCCCCACCCCTACCTTGCA GTCCCCGCAAGCTCATCTGCGCGAACCAGA ACGCCCACCACCCTTGGGTTGAAATTAAGGA GGCGGTTGGCAGCTTCCCAGGCGCACGTAC CTGCGAATAAATAACTGTCCGCACAAGGAGC CCGACGATAGTCGACCCTCTCTAGTCACGAC CTACACACAGAACCTGTGCTAGACGCCATGA GATAAGCTAACACAAAAACATTTCCCACTAC TGCTGCCCGCGGGCTACCGGCCACCCCTGG CTCAGCCTGGCGAAGCCGCCCTTCA Let us start with visualizing a special data type, DNA. The DNA of two species… Are they similar? CCGTGCTAGGGCCACCTACCTTGGTCCG CCGCAAGCTCATCTGCGCGAACCAGAAC GCCACCACCTTGGGTTGAAATTAAGGAG GCGGTTGGCAGCTTCCAGGCGCACGTAC CTGCGAATAAATAACTGTCCGCACAAGG AGCCGACGATAAAGAAGAGAGTCGACCT CTCTAGTCACGACCTACACACAGAACCT GTGCTAGACGCCATGAGATAAGCTAACA

6 Time Series Data Mining Group CT AG CT AG CT AG CT AG CT AG CT AG CCGTGCTAGGGCCACCTACCTTGGTCCG CCGCAAGCTCATCTGCGCGAACCAGAAC GCCACCACCTTGGGTTGAAATTAAGGAG GCGGTTGGCAGCTTCCAGGCGCACGTAC CTGCGAATAAATAACTGTCCGCACAAGG AGCCGACGATAAAGAAGAGAGTCGACCT CTCTAGTCACGACCTACACACAGAACCT GTGCTAGACGCCATGAGATAAGCTAACA

7 Time Series Data Mining Group CCGTGCTAGGGCCACCTACCTTGGTCCG CCGCAAGCTCATCTGCGCGAACCAGAAC GCCACCACCTTGGGTTGAAATTAAGGAG GCGGTTGGCAGCTTCCAGGCGCACGTAC CTGCGAATAAATAACTGTCCGCACAAGG AGCCGACGATAAAGAAGAGAGTCGACCT CTCTAGTCACGACCTACACACAGAACCT GTGCTAGACGCCATGAGATAAGCTAACA CCCTTCTT CACGTATC ACATGCGT AAAGGAGG CT AG CCCCCTCTC CCACCGCTA CACCAT CAA CCCTTCTT CACGTATCACATGCGT AAAGGAGG CCCTTCTTCCCTTCTT CACGTATCCACGTATG ACATGCGTACATGCGT AAAGGAGGAAAGGAGG CT AG CT AG CCCCCTCTC CCACCGCTA CACCAT CAA CCCTTCTT CACGTATCACATGCGT AAAGGAGG CCCTTCTTCCCTTCTT CACGTATCCACGTATC ACATGCGTACATGCGT AAAGGAGGAAAGGAGG CT AG CT AG CCCCCTCTC CCACCGCTA CACCAT CAA CCCTTCTTCCCTTCTT CACGTATCCACGTATC ACATGCGTACATGCGT AAAGGAGGAAAGGAGG CCCTTCTT CC CTTCTT CACGTATCCACGTATG ACATGCGTACATGCGT AAAGGAGGAAAGGAGG CT AG CT AG CCCCCTCTC CCACCGCTA CACCAT CAA

8 Time Series Data Mining Group CCGTGCTAGGCCCCACCCCTACCTTGCA GTCCCCGCAAGCTCATCTGCGCGAACCA GAACGCCCACCACCCTTGGGTTGAAATT AAGGAGGCGGTTGGCAGCTTCCCAGGCG CACGTACCTGCGAATAAATAACTGTCCGC ACAAGGAGCCCGACGATAGTCGACCCTC TCTAGTCACGACCTACACACAGAACCTG TGCTAGACGCCATGAGATAAGCTAACA CA ACAT AAAG CA ACATACAT AAAGAAAG CA ACAT AAAG CA ACATACAT AAAGAAAG CA ACATACAT AAAGAAAG 0.02 CA ACATACAT AAAGAAAG

9 Time Series Data Mining Group CCGTGCTAGGCCCCACCCCTACCTTGCA GTCCCCGCAAGCTCATCTGCGCGAACCA GAACGCCCACCACCCTTGGGTTGAAATT AAGGAGGCGGTTGGCAGCTTCCCAGGCG CACGTACCTGCGAATAAATAACTGTCCGC ACAAGGAGCCCGACGATAGTCGACCCTC TCTAGTCACGACCTACACACAGAACCTG TGCTAGACGCCATGAGATAAGCTAACA OK. Given any DNA string I can make a colored bitmap, so what?

10 Time Series Data Mining Group African elephant.dna Indian elephant.dna chimpanzee.dnahippopotamus.dna Human.dna orangutan.dna pygmy chimpanzee.dna pygmy sperm whale.dna rhesus monkey.dna sperm whale.dna white rhinoceros.dna Indian rhinoceros.dna African elephant.dna Indian elephant.dna chimpanzee.dnahippopotamus.dna Human.dna orangutan.dna pygmy chimpanzee.dna pygmy sperm whale.dna rhesus monkey.dna sperm whale.dna white Indian rhinoceros.dna African elephant.dna Indian elephant.dna chimpanzee.dnahippopotamus.dna Human.dna orangutan.dna pygmy chimpanzee.dna pygmy sperm whale.dna rhesus monkey.dna sperm whale.dna white Indian rhinoceros.dna

11 Time Series Data Mining Group Note Elephas maximus is the Indian Elephant, Loxodonta africana is the African elephant and Pan troglodytes is the chimpanzee.

12 Time Series Data Mining Group Can we make Intelligent Icons for time series? aaabbabb acadbcbd cacbdadb cccddcdd ab cd aaaaababa aacaadabc acaacb acc accbabcdbcabdbcadbacbdbdcadbaacb… Yes, with SAX! Time Series Bitmap b b b a c c c a

13 Time Series Data Mining Group While they are all example of EEGs, example_a.dat is from a normal trace, whereas the others contain examples of spike-wave discharges.

14 Time Series Data Mining Group We can further enhance the time series bitmaps by arranging the thumbnails by “cluster”, instead of arranging by date, size, name etc We can achieve this with MDS. July.txtJune.txtApril.txt May.txtSept.txt March.txt Oct.txtFeb.txt Nov.txtJan.txt Dec.txt August.txt January December August One Year of Italian Power Demand We can further enhance the time series bitmaps by arranging the thumbnails by “cluster”, instead of arranging by date, size, name etc We can achieve this with MDS.

15 Time Series Data Mining Group Text Example Here are some papers that reference Eamonn Keoghs work…

16 Time Series Data Mining Group Text Example

17 Time Series Data Mining Group Intelligent Icon Search

18 Time Series Data Mining Group Paper Summary We show how to map DNA, time series and natural language into intelligent icons. We give a generic framework for mapping any kind of data into intelligent icons. We show the utility of intelligent icons for finding patterns (clusters, outliers etc)

19 Time Series Data Mining Group Questions?


Download ppt "Time Series Data Mining Group Intelligent Icons: Integrating Lite-Weight Data Mining and Visualization into GUI Operating Systems Eamonn Keogh Li Wei Xiaopeng."

Similar presentations


Ads by Google