Presentation is loading. Please wait.

Presentation is loading. Please wait.

National Cancer Institute Slide Show on Single Nucleotide Polymorphisms [SNPS] ancer/geneticvariation.

Similar presentations


Presentation on theme: "National Cancer Institute Slide Show on Single Nucleotide Polymorphisms [SNPS] ancer/geneticvariation."— Presentation transcript:

1 National Cancer Institute Slide Show on Single Nucleotide Polymorphisms [SNPS] ancer/geneticvariation

2 Understanding Cancer and Related Topics Understanding SNPs and Cancer These PowerPoint slides are not locked files. You can mix and match slides from different tutorials as you prepare your own lectures. In the Notes section, you will find explanations of the graphics. The art in this tutorial is copyrighted and may not be reused for commercial gain. Please do not remove the NCI logo or the copyright mark from any slide. These tutorials may be copied only if they are distributed free of charge for educational purposes. Developed by: Susan Greenhut, M.S. Donna Kerrigan, M.S. Jeanne Kelly Brian Hollen Explains tiny variations in the human genome called Single Nucleotide Polymorphisms (SNPs) that can influence a person’s health. Shows how SNPs occur in both coding and noncoding regions and can cause silent, harmless, harmful, or latent effects. Shows how SNPs can be markers for cancer. Suggests that SNPs may also be involved in the different levels of individual cancer risk observed. Suggests that, in the future, SNPs databases may be used to improve cancer diagnosis and treatment planning.

3 Cancer – Different Fates

4 Cancer – A Complex Disease Diabetic islet cell Normal islet cellNormal lung cell Lung cancer cell Many years later

5 SNPs ASNPs B SNPs CSNPs D SNPs May Be the Solution

6 What Is the Human Genome? Human Cell Nucleus Chromosomes

7 DNA and Chromosome Structure DNA molecule (chromosome) Chemical bases A T G C

8 The Genome Contains Genes Gene 2 Coding region Protein 2 Protein 1 Noncoding region Gene 1 Coding region

9 Variation in the Human Genome Person 1Person 2 = Variations in DNA

10 What Is Variation in the Genome? Common Sequence Variations Polymorphism Deletions Translocations Insertions Chromosome

11 Variations Causing No Changes = Variations in DNA that cause no changes

12 Variations Causing Harmless Changes = Variations in DNA that cause harmless changes

13 Variations Causing Harmful Changes = Variation in DNA that causes harmful change No Disease Hemophilia

14 Variations Causing Latent Changes Many years later = Variations in DNA that cause latent effects

15 SNPs Are the Most Common Type of Variation At least 1 percent of the population Most of the population Common sequence G to C SNP site Variant sequence

16 Why Are SNPs Significant? Person 1Person 2 = SNP variations in DNA SNP marks Gene A Gene B Gene A SNP may cause Gene B to make altered protein

17 Amino Acids Lysine side chain 20 Different Amino Acids Basic Structure of an Amino Acid Graphic Representation of an Amino Acid Lysine Carboxyl group Amino group

18 Amino Acid Side Chains Water-Loving Lysine Water Oil Histidine Glutamic acid Aspartic acid Arginine

19 Amino Acid Side Chains Oil-Loving Alanine Water Oil Methionine Phenylalanine Proline CysteineTryptophan LeucineGlycineValine Isoleucine

20 Amino Acid Side Chains Ambivalent Water Oil Serine Tyrosine AsparagineThreonine Glutamine

21 Proteins Amino group Carboxyl group Peptide bond Amino group Carboxyl group Peptide bond

22 Genes to Proteins I DNA TACGCAATATGCATTTACGCAATATGCATT AUGCGUUAUACGUAAAUGCGUUAUACGUAA mRNA

23 Genes to Proteins II

24 Genes to Proteins III Ribosome mRNA tRNA A Codons: AUG=Methionine=Start CGU=Arginine UAU=Tyrosine ACG=Threonine UAA=Stop Methionine Arginine Threonine Tyrosine UGCGUUAUACUAAG StopTyrosineMethionine ThreonineArginine

25 Protein Folding and Function Amino acid chain grows and folds into a 3-D structure.

26 SNPs in Coding Regions – No Changes in Protein DNA SNP C to G RNA Codon CUG to CUC Protein Leucine to Leucine No change in shape Leucine mRNA G A C C U GC U C CUGCUC G A G

27 SNPs in Coding Regions – Subtle, Harmless Changes in Protein DNA SNP A to C RNA Codon GAU to GAG Protein Aspartic acid to Glutamic acid Slight change in shape Aspartic acidGlutamic acid mRNA C T A G A UG A G GAUGAG C T C

28 SNPs in Coding Regions – Harmful Changes in Protein – Mutations DNA SNP T to A RNA Codon GAU to GUU Protein Aspartic acid to Valine Change in shape Aspartic acid Valine mRNA C T G A UG U U GAUGUU C AAA

29 SNPs in Coding Regions – Subtle Changes in Proteins That Only Switch on Under Certain Conditions Smoking Switched-on genes Pattern A Many years later = SNPs causing latent effects Pattern B Many years later

30 Smoking and Susceptibility to Lung Cancer Water-Soluble Carcinogen Eliminator Carcinogen Activator Precarcinogen

31 Smoking and Susceptibility to Lung Cancer – SNPs in Carcinogen-Making Proteins Hyperactive Activator Lazy Activator Carcinogen Precarcinogen Carcinogen Precarcinogen

32 Smoking and Susceptibility to Lung Cancer – SNPs in Detoxifying Proteins Active Eliminator Lazy Eliminator Carcinogen Water-Soluble Carcinogen

33 Arylamines and Bladder Cancer Acetylator Deaminator Arylamines Precarcinogen Nonreactive compound (safely removed from body) Carcinogen

34 SNPs and Bladder Cancer Risk Lazy AcetylatorDeaminator Arylamines Precarcinogen Nonreactive compound (safely removed from body) Carcinogen

35 Not the Whole Story Bladder cancer patient United States Population Fast acetylators Slow acetylators =10 people

36 SNPs and Drug Interactions Transporter Drug Absorption in the breast Drug in breast tissue Metabolism in the liver Excretion in the kidney Drug becomes inactive or toxic Transportation in the blood Drug in bloodstream

37 SNPs in Noncoding Regions – Markers for Genes Gene Y SNP X Gene Y SNP X Gene Y SNP X

38 SNP Maps All SNPs are recorded SNP locationAll chromosomes are sequenced SNP Data

39 SNP profile A SNP profile B SNP profile F SNP profile E SNP profile DSNP profile C Individual SNP Profiles

40 SNP Profiles and Response to Drug Therapy Does Not Respond to Standard Drug Treatment Breast Cancer Patients Individual SNP Profiles Are Sorted SNP profile ASNP profile B SNP profile D SNP profile ESNP profile C Responds to Standard Drug Treatment

41 SNP Profiles May Help to Identify Cancer Genes CC gene 5 SNPs common in colon cancer patients are colon cancer gene markers CC gene 1 CC gene 2 CC gene 3 CC gene 4 Chrom E Chrom A Chrom BChrom CChrom D

42 SNPs and Cancer Risk Kidney cancer patients =10 people, SNP B =10 people, SNP A Normal population

43 Summary – SNPs and Cancer Research Better treatment for patients Patient A SNP profile

44 We would like to hear from you... If you have questions about this tutorial’s content, suggestions for new topics, or other feedback on the Web site, please send an to If you have questions about this tutorial’s artwork or want permission to use it, please send an to


Download ppt "National Cancer Institute Slide Show on Single Nucleotide Polymorphisms [SNPS] ancer/geneticvariation."

Similar presentations


Ads by Google