Presentation is loading. Please wait.

Presentation is loading. Please wait.

Konstruksi dan ekspresi gen  -amilase B. aquimaris MKSC 6.2 rekombinan.

Similar presentations


Presentation on theme: "Konstruksi dan ekspresi gen  -amilase B. aquimaris MKSC 6.2 rekombinan."— Presentation transcript:

1 Konstruksi dan ekspresi gen  -amilase B. aquimaris MKSC 6.2 rekombinan

2 ATGAAAAGAAGAGTACTATCTCTCATTTTAGTCCCGTTTCTTCTTTTTTACGCCCTTCCGGTAGGTGCAGTTGAAAAAGAAGAACGAAAG M K R R V L S L I L V P F L L F Y A L P V G A V E K E E R K TGGCAGGATGAAACAATTTATTTCCTAATGGTAGATCGCTTTAACAATGGTGATCCAACAAATGATAAAGAAGTGAACACAAAGGATCCC W Q D E T I Y F L M V D R F N N G D P T N D K E V N T K D P AAGGCTTACCATGGCGGTGATTTCCAAGGGGTTATCGATCGATTGGATTACATCAAAGATATGGGATTCACTTCCATATGGCTGACTCCC K A Y H G G D F Q G V I D R L D Y I K D M G F T S I W L T P GTATTTGACAACCAGCCAAAAGGATACCATGGATATTGGATTACGGACTTTTATAAGACCGACGAGCATTTCGGTACGATGGAAACGTTC V F D N Q P K G Y H G Y W I T D F Y K T D E H F G T M E T F AAAAAGCTTGTAGAAGAAGCACATAAGCGGGATATGAAAGTCGTCCTTGATTTTGTGGTTAACCATGTGGGGCCGGAGCATCCCTGGGTG K K L V E E A H K R D M K V V L D F V V N H V G P E H P W V GATGACCCTGCAAAAGAAGACTGGTTCCACGAAAAACAGCCAATGAACTTCTCCGACAAAGAAAGTCTTCAGAACGCATGGCTGTATGAC D D P A K E D W F H E K Q P M N F S D K E S L Q N A W L Y D CTTCCTGATTTAAACACAGAGAATCCCGAAGTAAGGGAATATCTCTTTGATGCTGCCAAATGGTGGATCAAAGAAACGGATGTCGACGGT L P D L N T E N P E V R E Y L F D A A K W W I K E T D V D G TATCGTCTGGACACGGTGCGCCATGTTCCACAAGATTTTTGGAGTGATTTCAGTAAAGAAGTTAAATCAGTGAAAGACGATTTTTATCTT Y R L D T V R H V P Q D F W S D F S K E V K S V K D D F Y L CTTGGTGAAGTGTTTGATCGTGACCCACAGAAGATAGCAGAATATAACGATGTGGGTATCGATGGATTCGTTAATTTCCCCCAAGCTGAA L G E V F D R D P Q K I A E Y N D V G I D G F V N F P Q A E GAATTACGTTCAGTGTTTAACAAACCTGATACTTCAATGGACAGGTTGTTCAATTTCTGGAAGTACAATGAAACATTTTATGAAGATCCT E L R S V F N K P D T S M D R L F N F W K Y N E T F Y E D P TATTTGATGGGGACTTTTATAGACAACCATGATATGGAACGTTTTACACGTTTATTGGTACAGGAAAATGTTTTCCCTGGTACCCGTTGG Y L M G T F I D N H D M E R F T R L L V Q E N V F P G T R W AAACTCGCCTTGACATATATGTACACGACTCCGGGAATACCGATTGTGTATTATGGGTCTGAAATTGCCATGGATGGCGGGGAAGACCCG K L A L T Y M Y T T P G I P I V Y Y G S E I A M D G G E D P GATAACCGGCGGTTGATGAATTTCAGGGCCGACAAAGAACTGATTGATTACATTTCAAAACTGGGCAAGGTTCGAAAGGACTATCCTGCT D N R R L M N F R A D K E L I D Y I S K L G K V R K D Y P A TTGACAAGAGGAACGATAGAGCCGTTGTATGAACAAGACGGATTGGGAATATATAAACGCGCATACAAAGATCAAACGGTGGTTGTAGCC L T R G T I E P L Y E Q D G L G I Y K R A Y K D Q T V V V A ATCAATAATTCCAGTGAGACCCAAACTGTCGAACTTGATGAAGGGGAGCTTGCTGATAACAATGAACTAAAAGGGTTACTTTCAGATGAC I N N S S E T Q T V E L D E G E L A D N N E L K G L L S D D CTGGTGAGAAGCGATGAAAACGGGACGTATAAAGTCGCTTTGGATCGTGAAGAAGCAGAGATTTATCTGCTTAAAGCCAAAAGTGGACTG L V R S D E N G T Y K V A L D R E E A E I Y L L K A K S G L AACATCCCATATTTATCAGCACTTGCTGCGGTGTATGTATTATTTTTATTATTTATTTATCTAGTATGGAAACGCGGAAGAAAAAACCGC N I P Y L S A L A A V Y V L F L L F I Y L V W K R G R K N R AAATCATAA 1539 bp K S. 512 aa Urutan Gen  -Amilase B. aquimaris MKSC 6.2  Memperoleh protein yang diinginkan dalam jumlah yang cukup

3 DNA genom Vektor ekspresi ligasi Transformasi cloning host PCR Enzim restriksi Isolasi plasmid rekombinan Analisis Transformasi expression host Enzim restriksi ekspresi Protein rekombinan

4 1.Promoter 2.Rbs 3.Start codon (ATG) 4.Signal sequence  ekspor ke periplasmik 5.His-tag  pemurnian

5 Merancang Primer Ujung 5’ primer diberi sisi restriksi Sisi restriksi harus ada pada mcs vektor tapi tidak ada pada gen. Sisi restriksi vektor dan gen harus kompatibel. Hasil rekombinasi harus in frame

6 Gen disisipkan pada multiple cloning site (mcs)

7

8 Compatibility blunt-blunt: selalu kompatibel blunt-sticky: tidak pernah kompatibel Pemotongan dengan enzim restriksi yang sama selalu kompatibel Alu I AGCT AG CT TCGA TC GA Cla I ATCGAT AT CGAT TAGCTA TAGC TA Alu I AGCT AG CT AGAAA TCGA TC GA TCTTT Dra I TTTAAA TTT AAA TTTCT AAATTT AAA TTT AAAGA

9 sticky-sticky: tidak kompatibel Cla I ATCGAT AT CGAT TAGCTA TAGC TA Hind III AAGCTT A AGCTT TTCGAA TTCGA A sticky-sticky: kompatibel Cla I ATCGAT AT CGAT ATCGG TAGCTA TAGC TA TAGCC Hpa II CCGG C CGG CCGAT GGCC GGC C GGCTA

10 ATGAAAAGAAGAGTACTATCTCTCATTTTAGTCCCGTTTCTTCTTTTTTACGCCCTTCCGGTA MetLysArgArgValLeuSerLeuIleLeuValProPheLeuLeuPheTyrAlaLeuProVal EcoRV GATATCATGAAAAGAAGAGTAC AspIleMetLysArgArgVal NcoI CCATGGATGAAAAGAAGAGTAC MetAspGluLysLysSer CCATGGTGAAAAGAAGAGTAC MetValLysArgArgVal CCATGGTTATGAAAAGAAGAGTAC MetValMetLysArgArgVal

11 Vektor-T Hasil PCR dengan menggunakan Taq DNA polymerase memiliki ekor-A pada ujung 3’ Vektor-T: vektor kloning, dilinearkan dengan enzim restriksi menghasilkan blunt-end kemudian ditempeli ekor-T pada ujung 3’

12 A A T T

13 DNA genom DNA vektor ligasi Transformasi cloning host PCR Enzim restriksi Isolasi plasmid rekombinan Analisis Transformasi expression host Enzim restriksi ekspresi Protein rekombinan

14 Fragmen yg akan disisipkan mudah dideteksi Dapat di sekuensing untuk mengetahui benar/tidaknya sisi restriksi M M. Marker 1.pGEM-Insert/EcoRI/EcoRV 2.pGEM-Insert/EcoRI 3.pGEM-Insert/EcoRI/EcoRV 4.PGEM-Insert/EcoRV pGEM/EcoRI/EcoRV

15 ATGAAAAGAAGAGTACTATCTCTCATTTTAGTCCCGTTTCTTCTTTTTTACGCCCTTCCGGTAGGTGCAGTTGAAAAAGAAGAACGAAAG M K R R V L S L I L V P F L L F Y A L P V G A V E K E E R K TGGCAGGATGAAACAATTTATTTCCTAATGGTAGATCGCTTTAACAATGGTGATCCAACAAATGATAAAGAAGTGAACACAAAGGATCCC W Q D E T I Y F L M V D R F N N G D P T N D K E V N T K D P AAGGCTTACCATGGCGGTGATTTCCAAGGGGTTATCGATCGATTGGATTACATCAAAGATATGGGATTCACTTCCATATGGCTGACTCCC K A Y H G G D F Q G V I D R L D Y I K D M G F T S I W L T P GTATTTGACAACCAGCCAAAAGGATACCATGGATATTGGATTACGGACTTTTATAAGACCGACGAGCATTTCGGTACGATGGAAACGTTC V F D N Q P K G Y H G Y W I T D F Y K T D E H F G T M E T F AAAAAGCTTGTAGAAGAAGCACATAAGCGGGATATGAAAGTCGTCCTTGATTTTGTGGTTAACCATGTGGGGCCGGAGCATCCCTGGGTG K K L V E E A H K R D M K V V L D F V V N H V G P E H P W V GATGACCCTGCAAAAGAAGACTGGTTCCACGAAAAACAGCCAATGAACTTCTCCGACAAAGAAAGTCTTCAGAACGCATGGCTGTATGAC D D P A K E D W F H E K Q P M N F S D K E S L Q N A W L Y D CTTCCTGATTTAAACACAGAGAATCCCGAAGTAAGGGAATATCTCTTTGATGCTGCCAAATGGTGGATCAAAGAAACGGATGTCGACGGT L P D L N T E N P E V R E Y L F D A A K W W I K E T D V D G TATCGTCTGGACACGGTGCGCCATGTTCCACAAGATTTTTGGAGTGATTTCAGTAAAGAAGTTAAATCAGTGAAAGACGATTTTTATCTT Y R L D T V R H V P Q D F W S D F S K E V K S V K D D F Y L CTTGGTGAAGTGTTTGATCGTGACCCACAGAAGATAGCAGAATATAACGATGTGGGTATCGATGGATTCGTTAATTTCCCCCAAGCTGAA L G E V F D R D P Q K I A E Y N D V G I D G F V N F P Q A E GAATTACGTTCAGTGTTTAACAAACCTGATACTTCAATGGACAGGTTGTTCAATTTCTGGAAGTACAATGAAACATTTTATGAAGATCCT E L R S V F N K P D T S M D R L F N F W K Y N E T F Y E D P TATTTGATGGGGACTTTTATAGACAACCATGATATGGAACGTTTTACACGTTTATTGGTACAGGAAAATGTTTTCCCTGGTACCCGTTGG Y L M G T F I D N H D M E R F T R L L V Q E N V F P G T R W AAACTCGCCTTGACATATATGTACACGACTCCGGGAATACCGATTGTGTATTATGGGTCTGAAATTGCCATGGATGGCGGGGAAGACCCG K L A L T Y M Y T T P G I P I V Y Y G S E I A M D G G E D P GATAACCGGCGGTTGATGAATTTCAGGGCCGACAAAGAACTGATTGATTACATTTCAAAACTGGGCAAGGTTCGAAAGGACTATCCTGCT D N R R L M N F R A D K E L I D Y I S K L G K V R K D Y P A TTGACAAGAGGAACGATAGAGCCGTTGTATGAACAAGACGGATTGGGAATATATAAACGCGCATACAAAGATCAAACGGTGGTTGTAGCC L T R G T I E P L Y E Q D G L G I Y K R A Y K D Q T V V V A ATCAATAATTCCAGTGAGACCCAAACTGTCGAACTTGATGAAGGGGAGCTTGCTGATAACAATGAACTAAAAGGGTTACTTTCAGATGAC I N N S S E T Q T V E L D E G E L A D N N E L K G L L S D D CTGGTGAGAAGCGATGAAAACGGGACGTATAAAGTCGCTTTGGATCGTGAAGAAGCAGAGATTTATCTGCTTAAAGCCAAAAGTGGACTG L V R S D E N G T Y K V A L D R E E A E I Y L L K A K S G L AACATCCCATATTTATCAGCACTTGCTGCGGTGTATGTATTATTTTTATTATTTATTTATCTAGTATGGAAACGCGGAAGAAAAAACCGC N I P Y L S A L A A V Y V L F L L F I Y L V W K R G R K N R AAATCATAA 1539 bp K S. 512 aa Urutan Gen  -Amilase B. aquimaris MKSC 6.2

16 Konstruksi vektor ekspresi rekombinan Sel inang: E. coli Primer PCR Forward: gatatcGAAGAACGAAAGTGGCAG Reverse: gaattcGATTTGCGGTTTTTTCTTCCG 5000 pb 4000 pb 3000 pb 2000 pb 1500 pb

17 Analisis plasmid rekombinan Analisis restriksi  ada atau tidak insert Sekuensing  apakah urutannya benar 6900 pb 5400 pb 1500 pb

18

19 Sel Inang Cloning host E. coli: TOP10, JM101, JM109, DH5 , DH10β Expression host E. coli: BL21, origami, rosetta

20 Induksi: 0,5 mM IPTG selama 4 jam SDS-PAGE: 12% M T 0 T Metoda: Fuwa Substrat: 0,125% pati Inkubasi: 30 menit Suhu: 50 o C pH: 7 (Na-fosfat) Kontrol Sampel Ekspresi gen α-amilase B. aquimaris dalam E. coli BL21


Download ppt "Konstruksi dan ekspresi gen  -amilase B. aquimaris MKSC 6.2 rekombinan."

Similar presentations


Ads by Google