Presentation is loading. Please wait.

Presentation is loading. Please wait.

Breaking Barriers: getting biologists involved in everyday data integration using Moby Paul Gordon Genome Canada Bioinformatics Platform University of.

Similar presentations


Presentation on theme: "Breaking Barriers: getting biologists involved in everyday data integration using Moby Paul Gordon Genome Canada Bioinformatics Platform University of."— Presentation transcript:

1 Breaking Barriers: getting biologists involved in everyday data integration using Moby Paul Gordon Genome Canada Bioinformatics Platform University of Calgary, Canada

2 Outline concept, usage, future Getting Biologists Involved: Seahawk &

3 DNASequence NCBI_gi Sequence_Alignment

4

5 Core Moby Service Providers in Europe

6 Founding partner

7 SADI In A Nutshell

8 As OWL Axioms HomologousMutantImage is owl:equivalentTo { Gene Q hasImage image P Gene Q hasSequence Sequence Q Gene R hasSequence Sequence R Sequence Q similarTo Sequence R Gene R = “my gene of interest” }

9 Mobify the World.

10 Paul’s Maxims You cannot get rid of work You can: –Distribute work amongst parties with vested interests & required capabilities –Avoid redoing the same work repeatedly

11 Agenda Motivation Audience Mechanism

12 Larry Wall’s “Virtues of a Programmer” HUBRIS LAZINESSIMPATIENCE

13 Audience God Amoeba Taverna self-starters Willing to take training Capable but no hubris Self-perception of computer skills

14

15 Man’s Prayer I’m a man… But I can change… If I have to… I guess… Bioinformatician

16 Take the output of the U of C service and send it to iHOP, then send its output to DDBJ’s service…

17

18

19 myGRID RDF

20 Semantic Annotations for WSDL

21 bioxml.info

22 MOB Rule Syntax >gi| glycerol kinase cgatcagcatcgactagcatcgactatttgctatcat cagctacgatcagctacgactac…

23 Shared Responsibility Tu deviens responsable pour toujours de ce que tu as apprivoisé. Service Providers Proxy Provider Third Party Developers Biologists

24 SAWSDL Required Infrastructure Calgary (Sun v240) Calgary Anywhere Compute Cloud (e.g. Calgary or Google App Engine)

25 To Do Formal user studies HTML Form wrapping Enactment portal Biocatalogue? If you can not measure it, you can not improve it. – Lord Kelvin

26 Acknowledgements


Download ppt "Breaking Barriers: getting biologists involved in everyday data integration using Moby Paul Gordon Genome Canada Bioinformatics Platform University of."

Similar presentations


Ads by Google