1. Tucson High School Biotechnology Course Spring 2010

2. What do marine viruses do? Infect and Kill

3. What do marine viruses do? Transfer Genes + + Ex: Photosynthesis genes!! 10 28 base pairs of DNA per year in world’s oceans 10,000,000,000,000,000,000,000,000,000

4. What do marine viruses do? Alter their hosts Vibriocholerae + Choleratoxin

5. What do they infect? What genes do they transfer? How do they alter their host?

6. We need to use genetics… UNIVERSAL genes Bacteria have 16S gene Bacteria have 16S gene Eukaryotes have 18S gene NO universal gene for viruses!!

7. So we use CONCERVED genes

8. How will WE use genetics? … to find out what type of virus we have. MyovirusPodovirus psbA DNA pol g23 XX X X

9. PCR Forward primer Reverse primer standardstandardpsbA DNApolg23

10. How will WE use genetics? … to find out what type of virus we have. MyovirusPodovirus psbA DNA pol g23 XX X X

11. Transmission Electron Microscope Myovirus ??? e-e- e-e- e-e-

12. What then? PCR only tells us PRESENCE or ABSENCE DNA Sequencing atatggatcgagcttgac A string of letters… yay. We need BIOINFORMATICS!

13. Bioinformatics and Genomics Bonnie Hurwitz Graduate student TMPL

14. What can you do with a sequence? Gene Sequence Align it with gene sequences from other species Create a phylogeny showing how closely related species are to one another

15. Understand Functionally Meaningful Genetic Diversity 15 T4-like myoviruses from a diversity of hosts 0.1 substitutions per position GP2 MIT 9302 MIT 9201 MIT 9312 MIT 9401 AS9601 SB MIT 9314 MIT 9301 MIT 9215 RS810 MIT 9107 MB11F02 MB11E08 MED4 MIT 9515 MIT 9211 NATL2A PAC1 NATL1A SS120 MIT 9303 MIT 9313 RS8015 WH 8406 WH 8112 WH 8102 WH 8103 MB11A04 MB11E09 EBAC392 WH 6501 WH 8012 WH 8005 WH 8002 WH 8109 WH 8020 WH 9908 WH 8015 MIT S9220 WH 8017, WH 8018 RS9705 WH 7803 WH 8101 WH 5701 PCC 6307 High light Prochlorococcus Low light Prochlorococcus Marine Synechococcus 100/100 100/98 100/88 100/98 69/-- 89/83 97/94 99/64 100/99 70/-- 59/- - 66/ -- 95/93 100/98 Rocap et al. 2002. AEM

16. What can you do with a lot of sequences? What is a (meta)genome?

17. isolate Genomics Metagenomics community sequencing

18. Genome assembly

20. Shotgun sequencing (WGS) …ACGGCTGCGTTACATCGATCAT ACATCGATCATTTACGATACCATTG… sheared clone library (insert sizes of 1-2, 3- 4, 30-40, 100kb) end sequence clones (f / r) assemble reads by alignment identity genomic DNA

21. 1 2 3 4 5 6 7 8 break A B C D E F G H ABCDFG H E’E’’ mate pair linkage contig “composite” genome scaffold Genome scaffolding

22. Genome annotation is never done …

23. The first fourProchlorococcuscyanophage genomes - variations on coliphages (e.g., T4, T7 1 and “lambda” 2 ) - contain core photosynthesis genes 3,4 : - expressed during infection 5,6 - diversity generator for their hosts 4 - comprise ~60% of surface ocean microbial psbA genes 7 - contain other ‘host’ genes (Auxilliary Metabolic Genes = AMGs 8 ) … phycobilin biosynthesis, P stress, C metabolism, nucleotide metabolism 1 References : 1 Sullivan et al. 2005. PLoS Biol., 2 Sullivan et al. in prep., 3 Lindell & Sullivan et al. 2004. PNAS, 4 Sullivan & Lindell et al. 2006. PLoS Biol., 5 Lindell et al. 2005. Nature, 6 Lindell et al. 2007. Nature, 7 Sharon et al. 2007. ISMEJ, 8 Breitbart, Thompson, Suttle & Sullivan. 2007. Oceanography Cyano 11% Hypothetical 60% 15% T4-like 14% “phage” “bacterial” P-SSM4

24. Metagenome assembly

27. 110100100010000 Acid mine drainage Sargasso SeaSoil Species complexity Community complexity

28. Environmental Sample Extract DNACloneHigh throughput sequence Assemble readsCall genes Bin fragments Library Type: Shotgun (small-insert) 3kb Fosmid (large-insert) 40 kb BAC (large-insert) BIG STUFF! Sheared Size selection Community genomics (a.k.a. metagenomics)

29. = Environmental Gene Tags Predict ORFs (genes) in sequence data Assign a function to ORFs Compare relative abundance across habitats What to do with the data? EGTs

30. genome transcriptome proteome bacteria & archaeaviruses genome transcriptome proteome genome transcriptome proteome eukaryotes microbial communities DNA RNA protein Metagenomics is but the first level

31. Summary The smallest but arguably most important ocean inhabitants are microbes and phages Using metagenomics to sequence previously undetectable microbes and phages has expanded our knowledge of the oceans’ ecosystems Looking a genes in genomes can give us an idea of the potential function and role these organisms play in ocean ecology Looking at gene expression can tell us which genes are playing an active role in the ecosystem and who the major players are

32. Our goals Assemble and annotate a phage genome – Next Tuesday and Thursday Build a gene phylogeny and determine what phage you have based on it’s relationship to other phages – April 6th

33. phyto- plankton grazershigher trophic levels bacteria Dissolved viral lysis