Presentation is loading. Please wait.

Presentation is loading. Please wait.

Minimal Residual Disease analysis in childhood ALL Dr Jerry Hancock Scientific Co-ordinator of UKMRD Laboratory Network Bristol Genetics Lab.

Similar presentations


Presentation on theme: "Minimal Residual Disease analysis in childhood ALL Dr Jerry Hancock Scientific Co-ordinator of UKMRD Laboratory Network Bristol Genetics Lab."— Presentation transcript:

1 Minimal Residual Disease analysis in childhood ALL Dr Jerry Hancock Scientific Co-ordinator of UKMRD Laboratory Network Bristol Genetics Lab

2 Survival in Childhood ALL Survival

3 Prognostic factors used to direct therapy  Fixed factors Age, sex, white cell count at diagnosis, cytogenetics Age, sex, white cell count at diagnosis, cytogenetics  Dynamic factors response to treatment correlates with prognosis response to treatment correlates with prognosis slow early response (SER) assessed by microscopy predicts relapseslow early response (SER) assessed by microscopy predicts relapse predicts outcome within groups of children with the same fixed risk factors receiving the same therapypredicts outcome within groups of children with the same fixed risk factors receiving the same therapy BUT the microscope is an insensitive tool for detection of residual leukaemia and most destined to relapse have a rapid responseBUT the microscope is an insensitive tool for detection of residual leukaemia and most destined to relapse have a rapid response

4 Intensity of Therapy Analysis of outcome for MRC UKALL 97/99 Trial - Stratification of Treatment based on “clinical risk” TreatmentCharacteristicsN Arm A <10 yrs AND WCC <50 AND RER 62 Arm B >10 yrs or WCC >50 AND RER 22 Arm C A or B AND SER Or poor cytos 16

5 Intensity of Therapy Analysis of outcome for MRC UKALL 97/99 Trial - Stratification of Treatment based on “clinical risk” TreatmentCharacteristicsN EFS (%) Arm A <10 yrs AND WCC <50 AND RER 6284 Arm B >10 yrs or WCC >50 AND RER 2270 Arm C A or B AND SER Or poor cytos 1670

6 Intensity of Therapy Only 20% of relapse comes from highest risk group Many of those cured are over-treated Analysis of outcome for MRC UKALL 97/99 Trial - Stratification of Treatment based on “clinical risk” TreatmentCharacteristicsN EFS (%) Relapse Arm A <10 yrs AND WCC <50 AND RER (52%) Arm B >10 yrs or WCC >50 AND RER (28%) Arm C A or B AND SER Or poor cytos (20%)

7 Minimal Residual Disease Haematologic remission MRD “cure” Relapse MRD Analysis Follow-up In years Detection limit of PCR technique Detection limit of cytomorphology Relative frequency of leukaemic cells

8 MRD shown to have independent prognostic value in ALL  Childhood ALL van Dongen et al 1998 van Dongen et al 1998 Cavé et al 1998 Cavé et al 1998 Coustan-Smith et al 1998 Coustan-Smith et al 1998  Relapsed childhood ALL Knechtli et al 1998 Knechtli et al 1998 Eckert et al 2001 Eckert et al 2001 Goulden et al 2003 Goulden et al 2003  Adult ALL Bruggeman et al 2006 Bruggeman et al 2006 Raff et al 2007 Raff et al 2007 Prognostic value of MRD

9 van Dongen et al, Lancet 1998 = 98% = 20% = 78%

10 Quantitative MRD Detection Three methods currently available : 1. Flow cytometric immunophenotyping Utilises tumour associated aberrant immunophenotypes Utilises tumour associated aberrant immunophenotypes E.g. Presence of myeloid markers on leukaemia blastsE.g. Presence of myeloid markers on leukaemia blasts 2. Reverse transcriptase (RT) PCR Utilises tumour specific RNA targets Utilises tumour specific RNA targets E.g. Fusion gene transcriptsE.g. Fusion gene transcripts 3. Real-time Quantitative (RQ) PCR Utilises patient-specific gene rearrangements Utilises patient-specific gene rearrangements E.g. Immunoglobulin and T-cell receptor gene rearrangementsE.g. Immunoglobulin and T-cell receptor gene rearrangements  Utility of method chosen depends upon the aim of the study Important considerations: applicability, stability, sensitivity & quantitation Important considerations: applicability, stability, sensitivity & quantitation  RQ-PCR methodology is method of choice in most European MRD-based clinical trials

11 RQ-PCR for MRD analysis  Methodology identifies unique Immunoglobulin and/or T-cell receptor gene rearrangements that are clone-specific 98% of patients will have at least one clonal rearrangement 98% of patients will have at least one clonal rearrangement  Two patient-specific RQ-PCR assays are designed for each patient capable of detecting one leukaemic cell in a background of 10,000 marrow cells capable of detecting one leukaemic cell in a background of 10,000 marrow cells Important to prevent false-negative results due to clonal evolutionImportant to prevent false-negative results due to clonal evolution 80-85% of patients will have two assays quantitative to 1 in 10, % of patients will have two assays quantitative to 1 in 10,000

12 Scheme of Investigation - identification of patient-specific MRD marker  PCR analysis of diagnostic DNA  Heteroduplex analysis of PCR products  Purify and sequence clonal rearrangement  Synthesis of base patient-specific oligonucleotide TTGTAGTAGTTACCAGCTGGGCTATGAATACTTCCAGCACTGGG D regionJ regionN region Identification of V, D and J segment usage  In Patient-specific RQ-PCR for MRD Analysis

13 ALL2003 Randomisation Algorithm

14 UKMRD Laboratory Network Bristol Glasgow Sheffield Barts Barts & Royal London Great Ormond Street Middlesex Royal Marsden St Georges University College University Hospital Cambridge Bristol Cardiff Leeds Oxford Southampton Glasgow Aberdeen Belfast Dublin Dundee Edinburgh Liverpool Newcastle Sheffield Birmingham Derby Leicester Manchester Nottingham Norwich

15 MRD risk groups by Regimen - January 2009 CharacteristicsRegisteredMRD High risk MRD Low risk Regimen A <10 yrs AND WCC <50 AND RER (28%) 288 (30%) Regimen B >10 yrs or WCC >50 AND RER (34%) 155 (24%) Total (30%) 443 (28%)

16 Event Free Survival By Trial PERCENT TIME IN YEARS 74% 80% 88% At risk: ALL97 ( ) ALL97-99 ( ) ALL2003 (2003-) ALL97 ( ) ALL97-99 ( ) ALL2003 ( )

17 ALL PATIENTS PERCENT TIME IN YEARS 16% 8% At risk: ALL97-99 ( ) ALL2003 (2003-) ALL97-99 ( ) ALL2003 (2003-) No. Patients No. Events Obs./ Exp. ALL97-99 ( ) ·2 ALL2003 (2003-) ·7 2P = 0·0001 Relapse Risk By Trial

18 Event Free Survival by MRD Risk Group PERCENT TIME IN YEARS At risk: HIGH LOW INDETERMINATE HIGH = 78% LOW = 95% INDETERMINATE = 85% No. Patients No. Events Obs./ Exp. HIGH638681·5 LOW604120·3 INDETERMINATE738701·2 15-JAN-09 17:51:15

19 Proposals for ALL 2010   All patients on ALL 2020 will have therapy allocated based on MRD Treatment on ALL 2003 is currently randomised based on MRD Including risk groups A, B and C MRD Analysis done at day 28 and week 11   Sequential analysis of High Risk disease at 2 or 3 extra time-points Identification of patients with Very High Risk disease Novel therapies employed BMT?

20 Acknowledgements  Members of UKMRD network: - Barts Gary Wright Maggie Corbo Sheela Medahunsi Ulrika Johannson Susannah Akiki Bristol Jerry Hancock Paul Archer Richard Hathway Kayleigh McDonagh Paula Waits Nigel Wood GlasgowSandra Chudleigh Mary Gardiner Frances Fee Linda Smith Nicola Craig Anne Sproul Steve McKay SheffieldGill Wilson Helen Stuart Shilpa Haridas Amal Afifi Miranda Durkie Jane Holden Richard Kirk James Blackburn  Clinical Co-ordinator: - Nick Goulden  UKMRD Steering Committee:- Nick Cross Ajay Vora Brenda Gibson David Grant Christine Harrison Finbarr Cotter John Moppett  CLWP and ALL Task Force  ESG-MRD-ALL:- Jacques van Dongen Vincent van der Velden  I-BFM MRD Group


Download ppt "Minimal Residual Disease analysis in childhood ALL Dr Jerry Hancock Scientific Co-ordinator of UKMRD Laboratory Network Bristol Genetics Lab."

Similar presentations


Ads by Google