Presentation is loading. Please wait.

Presentation is loading. Please wait.

Martin Wiedmann Department of Food Science 412 Stocking Hall Cornell University Phone: 607-254-2838 Microbial food safety issues.

Similar presentations


Presentation on theme: "Martin Wiedmann Department of Food Science 412 Stocking Hall Cornell University Phone: 607-254-2838 Microbial food safety issues."— Presentation transcript:

1 Martin Wiedmann Department of Food Science 412 Stocking Hall Cornell University Phone: Microbial food safety issues – real world problems that get undergrads excited about microbiology

2 Foodborne diseases Latest CDC estimates indicate the following annual burdens due to foodborne diseases in the US per year: 325,000 serious illnesses resulting in hospitalizations 76 million cases of gastrointestinal illnesses 5,000 deaths

3 Transmission of foodborne diseases Manure Plant derived raw products Humans Animal feed/environment/protozoans Food animals Animal derived food products Food Processing Plants RTE Foods

4 Salmonella About 1.4 million cases annually in the US resulting in approx. 550 deaths Mostly gastrointestinal syndrome, but also invasive disease Bioterrorism agent Many different subtypes, e.g., Salmonella Typhi, Salmonella Dublin, Salmonella Typhimurium While cases caused by many foodborne pathogens (Listeria, Campylobacter, E. coli O157:H7) have decreased over the years, Salmonella case numbers have not Apparent increase in Salmonella resistant to one or more antibiotics has been observed

5 Antibiotic resistant Salmonella In 2002, 22% of Salmonella Newport, 27% of Salmonella Typhimurium isolates, and 8% of Salmonella Heidelberg displayed multi-drug resistance (MDR) MDR Salmonella Typhimurium isolates commonly shows two resistance type: (i) resistance to ampicillin, kanamycin, streptomycin, sulfamethoxazole, and tetracycline; or (ii) resistance to ampicillin, chloramphenicol, streptomycin, sulfamethoxazole, and tetracycline

6 Salmonella as bioterrorism agent Torok TJ, Tauxe RV, Wise RP, Livengood JR, Sokolow R, Mauvais S, Birkness KA, Skeels MR, Horan JM, Foster LR.Torok TJ, Tauxe RV, Wise RP, Livengood JR, Sokolow R, Mauvais S, Birkness KA, Skeels MR, Horan JM, Foster LR. A large community outbreak of salmonellosis caused by intentional contamination of restaurant salad bars. JAMA Aug 6;278(5):

7 Listeria monocytogenes Causes septicemia, abortion and encephalitis in humans and in animals Incubation period days Human listeriosis occurs in both epidemic and sporadic cases Affects predominantly elderly and immuno- compromised people, pregnant women and newborns. Approx. 2,500 human cases/year in the U.S., resulting in deaths/year Responsible for majority of microbial food recalls

8 E. coli O157:H7/Enterohemorhagic E. coli (EHEC) Severe human disease transmitted through many foods, including undercooked meat, raw milk, apple cider, raw vegetables, etc. Also transmitted by other means including drinking water, direct animal - human transmission Approx. 60,000 human cases and 50 deaths annually in US Symptoms include bloody diarrhea, hemolytic uremic syndrome (kidney damage) Children are particularly at risk

9 Noroviruses Noroviruses are most common cause of acute gastroenteritis in the United States and are believed to be the most common cause of food borne illnesses (23 million total cases annually, 9.2 million foodborne) Often associated with infections/outbreaks in “crowding situations” (cruise ships, homes for elderly etc.) Noroviruses cannot be grown in the laboratory Studies on heat resistance and disinfection strategies are difficult to perform Detection in foods and infected humans requires electron microscopy or molecular biology approaches Sources are most likely humans with infection that prepare or handle foods Virus appears to be able to survive on surfaces for days

10 Norwalk-like viruses: When the runs can slow you down In January 1999, an outbreak of viral gastroenteritis affected more than 300 people who attended a metropolitan concert hall over a 5-day period. The first case was a concert attendee who vomited in the auditorium and adjacent male toilet Gastrointestinal illness occurred among members of 8/15 school parties who attended the following day. Children who sat on the same level of the auditorium as the first case were much more likely to be ill than those seated elsewhere Transmission most likely occurred through direct contact with contaminated fomites (“any inanimate object or substance capable of absorbing, retaining, and transporting contagious or infectious organisms from one individual to another”).

11 Case study – human listeriosis outbreak

12 Human listeriosis cases in NYS 1/97-10/98

13 Ribotyping results - November 8, 9 pm

14 Ribotyping results - November 8, 12 pm

15 Epidemic curve for 1/97 - 2/99 in NYS

16 Follow-Up investigations by NYSDOH, Cornell University, CDC and other state health departments

17 Subtyping of human isolates - summary More than 100 human listeriosis cases and 21 deaths in more than 15 states; all caused by the identical DNA subtype

18 The outbreak source? Patients included in this outbreak were significantly more likely to have eaten hot dogs then controls November: matching subtypes found in opened packages of deli meats collected in retail (including deli meats produced by Sara Lee) by NYSAGM Middle of December: L. monocytogenes isolated from opened package of hot dogs from affected patient; subsequent tests reveal L. monocytogenes DUP-1044A contamination of unopened packages December 22, 1998: Sara Lee announces recall of hot dogs and other packaged meats produced at its Bil Mar Foods unit in Zeeland, MI

19 DNA fingerprinting methods

20 Molecular characterization and taxonomy AAACCC TTTGGG AAACCC TTTGGG AAACCC TTTGGG 700 kb 600 kb 1200 kb AAATCC TTTAGG AAACCC TTTGGG AAACCC TTTGGG 1300 kb1200 kb Gel Electrophoresis (separates DNA pieces by size) Bacterium #1 Bacterium #2 Bact #1Bact #2

21 PCR-RFLP characterization of hly PCR amplification of complete hly ORF, followed by restriction enzyme digest using HhaI and Hpa II Differentiates 8 different hlyA alleles M Uneven lanes: HhaI Even lanes: HpaII

22 Examples of different L. monocytogenes ribotypes

23 PFGE Types CC CC CC

24 DNA sequencing- based subtyping Isolate 1AACATGCAGACTGACGATTCGACGTAGGCTAGACGTTGACTG Isolate 2AACATGCAGACTGACGATTCGTCGTAGGCTAGACGTTGACTG Isolate 3AACATGCAGACTGACGATTCGACGTAGGCTAGACGTTGACTG Isolate 4AACATGCATACTGACGATTCGACGAAGGCTAGACGTTGACTG

25 Use of “DNA fingerprinting” to control Listeria in food processing plants

26 Sample Source * VISIT 2 VISIT 3 VISIT 1 * * * * * * * * * * * * * * * Sample Ribotype Sample Source RiboPrint® Pattern 1039C (E) Floor drain, raw materials area 1039C (E) Floor drain, hallway to finished area 1039C (IP) Troll Red King Salmon, in brine, head area 1039C (IP) Troll Red King Salmon, in brine, belly area 1039C (IP) Brine, Troll Red King Salmon 1039C (IP) Faroe Island Salmon, in brine, head area 1039C (F) Smoked Sable 1039C (F) Cold-Smoked Norwegian Salmon 1044A (E) Floor drain, brining cold room A (R) Raw Troll Red King Salmon, head area 1044A (IP) Brine, Faroe Island Salmon 1045 (R) Raw Troll Red King Salmon, belly area 1045 (IP) Faroe Island Salmon, in brine, head area 1053 (IP) Norwegian Salmon, in brine 1062 (E) Floor drain #1, raw materials preparation 1039C (E) Floor drain #1, raw materials preparation 1039C (E) Floor drain, brining cold room C (E) Floor drain #2, raw materials preparation 1039C (E) Floor drain #2, raw materials receiving 1039C (E) Floor drain, finished product area 1039C (E) Floor drain, hallway to finished area 1039C (IP) Brine, Troll Red King Salmon 1039C (F) Smoked Sable 1044A (IP) Sable, in brine 1044A (IP) Brine, Faroe Island Salmon 1062 (IP) Brine, Norwegian Salmon Subtyping Results – seafood processing plant Subtyping Results – seafood processing plant

27 VISIT 4 VISIT 5 * * * * * * * Sample Ribotype Sample Source RiboPrint® Pattern 1039C (E) Floor drain #1, raw materials preparation 1039C (E) Floor drain #1, raw materials receiving 1039C (IP) Brine, Atlantic Salmon 1039C (F) Cold-smoked Salmon trimmings 1062 (E) Floor drain #2, raw materials receiving 1044A (IP) Troll Red King Salmon, in brine 1048 (E) Floor drain #2, raw materials preparation 1052 (F) Smoked Sable 1053 (R) Raw Atlantic Salmon, in spawn 1053 (IP) Atlantic Salmon, in brine, head area 1053 (IP) Atlantic Salmon, in brine, belly area 1062 (E) Floor drain, brining cold room 1039C (E) Floor drain #2, raw materials preparation 1039C (E) Floor drain #2, raw materials receiving 1039C (F) Smoked Sea Bass 1042B (E) Floor drain #1, raw materials preparation 1042C (IP) Salmon-Trout, in brine 1044A (F) Smoked Sable 1062 (E) Floor drain #2, finished product area 1062 (E) Floor, finished product freezer 1062 (E) Floor drain #1, raw materials preparation Subtyping Results - cont. Subtyping Results - cont.

28 L. monocytogenes persistence in plants

29

30 2000 US outbreak - Environmental persistence of L. monocytogenes? 1988: one human listeriosis case linked to hot dogs produced by plant X 2000: 29 human listeriosis cases linked to sliced turkey meats from plant X

31 Ideas for food micro activities for undergrads Brainstorm about (1) what microorganisms cause foodborne illness (and how much), (2) what foods cause foodborne illness (and why), and (3) how can you reduce your personal risk of foodborne illness Use current examples (ProMed; FSNet) Lab activities (stage outbreak investigation): Can include simple (detection with selective media) to fairly complex (DNA sequencing with bioinformatics) lab activities

32 Food Micro resources FSNet: ProMed: The PathogenTracker game: o/introduction/welcome.htm o/introduction/w FightBac: Encyclopedia of Food Microbiology (can be made available on-line through institutional libraries) Food Microbiology: an Introduction (ASM Press) Food Microbiology: Fundamentals and Frontiers – more advanced (ASM Press) Modern Food Microbiology (CHIPS) Food Microbiology Laboratory (Taylor & Francis Ltd)

33 Summary and conclusions Foodborne disease affects everyone and foodborne disease burdens in US and internationally are not trivial Foodborne disease is a highly suitable topic for introducing undergrads to many/all concepts in microbiology Undergrad food micro education can be as simple and as complex as you wish

34


Download ppt "Martin Wiedmann Department of Food Science 412 Stocking Hall Cornell University Phone: 607-254-2838 Microbial food safety issues."

Similar presentations


Ads by Google