Presentation is loading. Please wait.

Presentation is loading. Please wait.

University of North Carolina at Chapel Hill, USA

Similar presentations


Presentation on theme: "University of North Carolina at Chapel Hill, USA"— Presentation transcript:

1 University of North Carolina at Chapel Hill, USA
Germplasm collection and characterization in tomatillo (Physalis philadelphica Lam.) Todd Vision Department of Biology University of North Carolina at Chapel Hill, USA

2 Solanaceae in North Carolina

3 Tomatillo (Physalis philadelphica Lam.)
Annual Self-incompatible Fruit enclosed by a papery calyx Native to Mexico Diploid (n=12) from Hernández Bermejo and León 1994

4 Ethnobotany of tomatillo
Culinary uses Salsa verde (usually with Capsicum) Infusion of calyx to make tamale dough Medicinal uses Leaves and fruits for headaches and stomachaches Juice for sore throats Cooked calyx for diabetes

5 Economic importance Cultivation mostly in Mexico and Guatemala
Fifth most important vegetable > 25,000 Ha cultivated/yr Elsewhere Equal importance in Guatemala Used by growing Mexican population in U.S.A. (esp. California) Used internationally in haute cuisine

6 Phylogeny of Solanaceae
Petunia, Brunfelsia Nicotianeae (Nicotiana) Anthocercideae Jaboroseae Nolanea Lycieae Hyoscyameae Nicandreae Datureae Solaneae (Solanum) Capsiceae (Capsicum) Physaleae (Physalis) Solandreae Mandragoreae From Olmstead et al Solanaceae IV

7 M. Whitson (2002) Two-gene phylogeny of the Physalinae rbcL and ITS
Leucophysalis viscosa Brachistus spp., Witheringia spp. Tzetalia spp P. alkekengi (Chinese lantern) Ocryctes spp, Leucophysalis nana, L. grandiflora P. microphysa P. arborescens Quincula lobata Chamaesaracha spp. P. crassifolia, P. acutifolia Margaranthus New World clade P. philadelphica (tomatillo) P. microcarpa, P. ignota, P. cordata, P. lagascae, P. pruinosa, P. angulata, P. pubescens P. nicandroides, P. peruviana (uchua), P. chenopodifolia, P. coztomatl, P. sordida, P. hederifolia, P. glutinosa, P. longifolia, P. greenmanii, P. caudella P. minima, P. lanceolata, P. hetrophylla, P. virginina, P. arenicola, P. pumila, P. mollis, P. viscosa, P. cinerascens, P. angustoflia, P. walteri U.S. perennials

8 Nomenclature Physalis philadelphica Lam. (= P. ixocarpa Brot.)
tomate from Nahuatl ayacach tomatl meaning berry Local names: miltomate (Oaxaca) tomate verde (Jalisco) tomatillo (Jalisco, Oaxaca, Puebla) tomate de cascara (Jalisco, Puebla, Oaxaca, Chiapas) tomate de hoja (Jalisco, Puebla) tomate de milpa, or miltomate, from its association with maize fields

9 Domestication Cultivation is ancient
Remains in the Valley of Tehuacán in Puebla Gradient of cultivation still visible But few modern cultivars Primitive features of landraces Self-incompatibility Indeterminate growth Nonsynchronous ripening Fruit drop Lack of clear wild relative

10 Fruit size variation

11 Classification of varieties
Work of Santaguillo Hernández and Peña Lomelí (Universidad Autónoma Chapingo) Mostly morphological Some molecular (AFLP) evidence Three most important varieties Rendidora (central and southern Mexico) Salamanca (Guatemala) Tamazula (in western Mexico)

12 variety habit fruiting yield fruit fruit color calyx color Rendidora crawling early high medium lemon green green Salamanca erect late large deep green clear green Tamazula purple green to purple Puebla verde crawling to semierect green with purple veins Manzano orange Arandas low small to medium Milpero cultivado crawling to erect very low very small green purple Milpero no cultivatado green, yellow, purple SF1 Chapingo very early very high

13 Summary of Hudson work Self-incompatibility and crossability
Model of domestication

14 Germplasm conservation

15 2002 Collecting Expedition
Sponsored by USDA Plant Exchange Office Maria Chacon and Todd Vision University of North Carolina Ofelia Vargas Ponce Universidad de Guadalajara Larry Robertson USDA-ARS Aureliano Peña Lomelí Universidad Autónoma Chapingo Andrew Jarvis CIAT

16 Existing collections seedbank herbarium both MEXICO Jalisco Michoacan
Guerrero Oaxaca Chiapas Puebla Michoacan seedbank herbarium both

17 Predicted priorities from FloraMap

18 Sources of collection Undisturbed vegetation (none)
Tomatillo fields Other fields (maize) Traditional markets Farmer’s seed stock

19 Classification of collections
Uncultivated From undisturbed or disturbed habitat, or a weed in a field occupied by other crops (maize) Incipient domesticate Casually but intentionally cultivated in fields devoted to other crops (maize) Landrace Cultivated for self-consumption or sale at a local market Escape Resembling a landrace but not found in a cultivated field

20 2002 collections Jalisco Puebla Michoacán Guerrero Chiapas Oaxaca
uncultivated incipient domesticate escape landrace

21 2002 collections State Uncult. Incip. Escape Landrace Collection sites
Chiapas Guerrero Hidalgo Jalisco Michoacán Oaxaca Puebla Total

22 Comparison of Mexican collections

23 P. angulata P. ampla

24 Local preferences Jalisco: purple fruit Puebla: large, green
Guerrero: yellow Chiapas: small and purple

25 Field trials Larry Robertson at USDA Plant Genetic Resources Unit (Geneva, New York) Tested 99 accessions from 2002 collection 4 plants per accession, one in a pollinator-exclusion cage Measured a suite of agronomic and domestication traits

26 Results of field trials
Domestication characters Agronomic characters BRIX Selfing Yield Interest from organic farmers

27 Uses of microsatellite markers
Genetic diversity Phylogeography and the origin of domestication Paternity analysis and varietal fingerprinting Genetic mapping Marker-assisted breeding

28 Microsatellites Simple Sequence Repeats (SSR), Short Tandem Repeats (STR) Mono (A) AAAAAAAAAAA Di (AT) ATATATATATATATAT Tri (ATC) ATCATCATCATCATCATCATC Tetra (CTAG)6 CTAGCTAGCTAGCTAGCTAGCTAG Imperfect GTGTGTGTATGTGTGT Interrupted GTGTGTGTCCCGTGTGTGT Compound GTGTGTGTCTCTCTCTCTCT

29 Microsatellites: advantages
Abundant Codominant Highly polymorphic Highly repeatable PCR-based Can be multiplexed for amplification or scoring

30 Development of SSR markers
Two strategies From enriched SSR libraries From tomato SSRs

31 Enrichment of SSRs Digest genomic DNA & ligate adapters
Hybridize to biotin-labeled SSR probes Capture with magnetic streptavidin beads Clone captured fragments Sequence inserts and design primers Screen primers for polymorphism (in 8 genotypes)

32 Enriched library results
11 libraries generated 1620 positive clones isolated 659 clones sequenced (w/ inserts bp). 205 (31%) clones contained one or more SSR SSRs represented 40 unique loci Primers designed for 24 loci Eight were easily scorable and highly polymorphic

33 Enriched library results

34 Transferring tomato SSRs
Primers developed for SSRs in tomato expressed sequence tags (from SGN, 24/87 (27.5%) primers amplified a product in tomatillo ~25% of di- and tri-nucleotides One out of nine among compound SSRs Six products were Approximately the expected size Yielded clean, bright bands Two were highly polymorphic

35 Tomatillo microsat markers

36 Cross-amplification of primers

37 Tests of Mendelian segregation
Segregation tested using ~50 F2 progeny per marker All 12 markers showed nuclear segregation One (SSR140) showed significant distortion No linkage detected among markers But not all marker combinations tested

38 Genetic diversity survey
Is there evidence for a genetic bottleneck within cultivated genotypes? Is there evidence for restricted gene flow Among geographic regions? Between cultivated and uncultivated genotypes? What is the geographic origin of cultivated genotypes?

39 Survey sample Includes germplasm from 69 genotypes
USDA BANGEV (Mexico) CATIE (Costa Rica, samples from Guatemala) 69 genotypes 39 different sites 19 sites represented by 2 or 3 genotypes 6 Guatemalan states and 15 Mexican states Cultivation status 21 uncultivated and 39 cultivated (all Mexican) 9 unknown (all Guatemalan)

40 Diversity and cultivation status
Cultivated Uncultivated Locus A He A He MIC MIC MIC MIC MIC MIC MIC MIC MIC MIC SSR SSR Mean

41 Physiographic provinces
Northern states Trans-Mexican Volcanic Belt Chiapas-Guatemala Sierra Madre del Sur © 1975 Board of Regents, The University of Texas

42 Population structure 0.1 N: Northern states,
T: Trans-Mexican Volcanic Belt, S: Sierra Madre del Sur C: Chiapas-Guatemala Weedy Cultivated 0.1

43 Analysis of Molecular Variation
By geographic province source d.f. SumSq %Var among groups within groups total By cultivation status source d.f. SumSq %Var among groups within groups total

44 Population structure analysis
Bayesian statistical approach for detecting admixed populations (Pritchard et al. 2000) Assigns individuals fractionally to K subpopulations Optimal model is K=2 (with prob~0.98) Six pairs of markers show significant gametic disequilibrium

45 Diffuse domestication: a hypothesis
Domestication in multiple regions? Extensive gene flow with uncultivated populations after domestication?

46 Future genetic work EST sequencing
Tod evelop molecular markers Crosses among self-compatible accessions To map the genetic markers Identify QTL for key domestication and agronomic traits Association mapping of candidate genes Shallow population structure High levels of diversity and recombination

47 Prospects for improvement
Traits of importance Determinate growth Self-compatibility Resistance to lodging Fruit retention Loose calyx

48 Pests and diseases Viruses Powdery mildew Coleoptera
Heliothis subflexa caterpillars

49 Conclusions Much potential for crop improvement of tomatillo
Germplasm resources are now available Variation for some traits (self-incompatibility) but not others (indeterminate growth) A panel of 12 microsatellites are now available Very little population structure Possibly diffuse domestication Extensive gene flow Excellent system for candidate gene association mapping

50 Many thanks to María Chacon and Maria Tsompana (UNC-CH)
Assistants Casey Kolb, Letycia Argote Nuñez, Leah Schinasi, Lindsey Swanson Larry Robertson (USDA) Aureliano Peña Lomelí (Chapingo) Ofélia Vargas de Ponce (Guadalajara) Andrew Jarvis (CIAT) Karen Williams (USDA Plant Exchange Office) USDA, CATIE, and BANGEV seed banks The many farmers who shared their seeds


Download ppt "University of North Carolina at Chapel Hill, USA"

Similar presentations


Ads by Google