Presentation is loading. Please wait.

Presentation is loading. Please wait.

Investigation Team: Prof. C.O.N. Ikeobi, Prof. M.O. Ozoje, Dr. A.O. Talabi, Dr. M. Okpeku and Dr. I.G. Imumorin PRESENTED BY Prof. C.O.N IKEOBI Department.

Similar presentations

Presentation on theme: "Investigation Team: Prof. C.O.N. Ikeobi, Prof. M.O. Ozoje, Dr. A.O. Talabi, Dr. M. Okpeku and Dr. I.G. Imumorin PRESENTED BY Prof. C.O.N IKEOBI Department."— Presentation transcript:

1 Investigation Team: Prof. C.O.N. Ikeobi, Prof. M.O. Ozoje, Dr. A.O. Talabi, Dr. M. Okpeku and Dr. I.G. Imumorin PRESENTED BY Prof. C.O.N IKEOBI Department of Animal Breeding and Genetics, College of Animal Science and Livestock Production MOLECULAR SCREENING OF MHC RESISTANCE GENES IN WEST AFRICAN DWARF GOATS An IFSERAR- sponsored project Research Project Number: UNAAB/IFSERAR/IGR47

2 INTRODUCTION Nigeria’s population currently estimated at 140 million is the most populous in Africa, commanding a ratio of one in five Africans and growing at 2-3% annually. It is estimated that livestock farming and herding accounts for about 10% of Nigeria’s Gross Domestic Product. Goats make substantial contributions to the subsistence sector of the economy in very many ways, most notable of which includes being easily adaptable to small-holder and subsistence management on account of small size, low-input management based on browsing rather than grazing in addition to being trypanotolerant in the Nigeria’s sub-humid and humid tropical climates characterized by high prevalence of tse-tse flies.

3 Despite these advantages, little attention had been paid to the genetic characterization and possible improvement of goats in Nigeria. Adu et al. (1979) studied reproductive performance and Buvanendran et al. (1981) and Moruppa (1985) reported on goat haemoglobin and transferrin alleles. These were followed more recently with other reports by Ebozoje and Ngere (1995), Odubote and Akinokun (1992), Odubote (1994) and Imumorin et al. (1999). The major histocompatibility complex (MHC) plays an important role in the adaptive immune response of vertebrates (Trowsdale, 1993). The MHC is an organized cluster of tightly linked genes with immunological and non-immunological functions, and is present in all vertebrates, except in jawless fish (Tizard, 2004).

4 The primary function of the MHC is to code for specialized antigen-presenting receptor glycoproteins. These molecules bind processed peptide antigens and present them to T lymphocytes, thereby triggering immune responses. The genes encoding these molecules are polymorphic, and in sheep, goats and cattle, high levels of polymorphism are observed in both the DRB and DQA genes (Ellis and Ballingall, 1999). The major aim of this study is to carry out a molecular screening of MHC resistance genes in West African Dwarf Goats.

5 OBJECTIVES BROAD OBJECTIVE Molecular Screening of MHC Resistance gene in West African Dwarf Goats. SPECIFIC OBJECTIVES To clone, characterize and sequence MHC genes in West Africa Dwarf goats To identify genetic variants in MHC genes in West African Dwarf goats To determine the association of MHC genotypes and quantitative traits in West African Dwarf goats as potential tools for marker- assisted selection.

6 MATERIALS AND METHODS Study Area. Study Population: 200 WAD goats were sampled. Data Collection: Data on both qualitative and quantitative traits as well as Heat stress data were collected on each animal. Blood Collection 10ml= 5ml(EDTA)+ 5ml(Heparinised) (DNA) ( Serum Analysis) DNA extraction was carried out using Zymobead genomic DNA extraction kits.

7 Primers: Primer3 was used to design the primer. This was then ordered from the Bioneer Primers. The Primer’s sequence for DRB 1 is A-T = Annealing temperature; bp = base pairs GenesPrimersA-TProductRef. DRB 1 F: TATCCCGTCTCTGCAGCACATTTC R: TCGCCGCTGCACACTGAAACTCTC 60 o C570 bp Amills et al. (1995)

8 PCR: PCR master mix from Bioneer was also used for the reaction. These primers were used in a PCR consisting of 30 cycles of: 94 C for 1 min, 60 0C for 1min and 72 0C for 1 min. Reactions were performed in 20 ml total volume. Agarose gel electrophoresis was performed using 1.5% agarose. The bands were snapped with the aid of a gel documentation system. The remaining PCR products were send to Cornell University core laboratory for sequencing.

9 The results of the sequence was used to design the restriction enzyme that will make a cut in the sequence using NEBCUTTER (an online tool). The resulting bands from the digested product was then genotyped manually to know whether the animal was homozygous or heterozygous for the DRB gene. HpyAV 5'... C C T T C (N) ' 3'... G G A A G (N) ' Helicobacter pylori 26695



12 Protein BLAST (Basic Local Alignment Search Tool) > dbj|BAA | - accession number in gene bank dbj|BAA | MHC class II DRB [Capra hircus] Length=89, Score = 124 bits (312), Expect = 1e-34, Method: Compositional matrix adjust. Identities = 57/71 (81%), Positives = 64/71 (91%), Gaps = 0/71 (0%)


14 References Buvanendran, V, Sooriyamoorthy, T, Ogunsusi, RA and Adu IF Haemoglobin polymorphism and resistance to helminths in red sokoto goats. Trop. Anim. Hlth. Prod. 13: 217 – 21. Ebozoje, MO and Ngere, LO Genetic analysis of preweaning growth in West African Dwarf goats and their half-breds. Inter J. Anim Sci. 10: 247 – 251. Ellis, S.A, and K.T.Ballingall Cattle MHC: Evolution in action? Immunol. Rev. 167: Tizard, I.R Acquired Immunity: antigen-presenting receptors. In: Veterinary Immunology: an introduction, Elsevier, Philadelphia, PA, USA, Trowsdole J Genomic structure and function in the MHC. Trends genet 9:


Download ppt "Investigation Team: Prof. C.O.N. Ikeobi, Prof. M.O. Ozoje, Dr. A.O. Talabi, Dr. M. Okpeku and Dr. I.G. Imumorin PRESENTED BY Prof. C.O.N IKEOBI Department."

Similar presentations

Ads by Google