Presentation is loading. Please wait.

Presentation is loading. Please wait.

“Using a Single Nucleotide Polymorphism to Predict Bitter Tasting Ability” SNP Lab Instructions.

Similar presentations


Presentation on theme: "“Using a Single Nucleotide Polymorphism to Predict Bitter Tasting Ability” SNP Lab Instructions."— Presentation transcript:

1 “Using a Single Nucleotide Polymorphism to Predict Bitter Tasting Ability” SNP Lab Instructions

2 Standard Using lab techniques, such as DNA extraction, PCR, restriction enzymes and gel electrophoresis to determine the presence or absence of a SNP in a designated gene sequence

3 With this lab, I can… Extract my own DNA from my cheek cells Amplify my DNA using PCR Understand how HAEIII enzyme will identify a SNP in genotype Determine my own genotype using gel electrophoresis

4 Supplies needed per lab group 2 – 1.5 ml tubes (label w/ class id #) 1 – dixie cup 1 – disposable 1 ml pipette 1 – µl micropipette 1 – box of pipette tips 1 – sharpie (fine point) Supplies needed per student

5 Step 1: Obtain some cheek cells 1 st - Swish vigorously 2 nd - Gently scrape cheek with toothpick & mix into cup

6 Step 2: Separate the cheek cells from the Gatorade/spit mix Think: Where is the DNA right now?

7 Step 3: Release the DNA from the cheek cells In heat block Detergent to break open cell membranes

8 Lab Journal Draw a flowchart that traces the DNA through part I of the lab

9 Step 4: Extract only the DNA from the mix Think: Where is the DNA right now?

10 Think-Pair-Share Why did we discard the supernatant and keep the pellet after the first centrifuge step, and keep the supernatant and discard the pellet after the second centrifuge step?

11 Standard Using lab techniques, such as DNA extraction, PCR, restriction enzymes and gel electrophoresis to determine the presence or absence of a SNP in a designated gene sequence

12 With this lab, I can… Extract my own DNA from my cheek cells Amplify my DNA using PCR Understand how HAEIII enzyme will identify a SNP in genotype Determine my own genotype using gel electrophoresis

13 Materials needed per student: 1 – PCR.2 ml tube w/ white bead 1 –.5 – 10 µl micropipette 1 – box pipette tips Materials needed per lab group:

14 Part II: PCR 22.5 μl 2.5 μl Pulse only

15 Materials needed per student: 2 – 1.5 ml tubes Label one tube “U” and the other tube “D” Also label with your class ID # 1 –.5 – 10 µl micropipette 1 – box pipette tips 1 – sharpie Materials needed per lab group:

16 Standard Using lab techniques, such as DNA extraction, PCR, restriction enzymes and gel electrophoresis to determine the presence or absence of a SNP in a designated gene sequence

17 With this lab, I can… Extract my own DNA from my cheek cells Amplify my DNA using PCR Understand how HAEIII enzyme will identify a SNP in genotype Determine my own genotype using gel electrophoresis

18 Part III: Digest DNA with HaeIII 10 μl Do this for both tubes 1 μl ONLY tube “D” Pulse only ONLY tube “D” Put Tube “U” back on ice. in heat block For 2 hours ONLY tube “D”

19 HaeIII and TAS2R38 gene HaeIII restriction enzyme –5’ GGCC5’ ---GG CC--- 3’ –3’ CCGG3’ ---CC GG--- 5’ TAS2R38 gene variations NONTASTER (t)TASTER (T) GGCGGGCACTGGCGGCCACT CCGCCCGTGACCGCCGGTGA

20 HaeIII and TAS2R38 gene NONTASTER (t)TASTER (T) GGCGGGCACTGGCGGCCACT CCGCCCGTGACCGCCGGTGA –One band - Two bands –Full length of gene- One band 177 bp 220 bp- One band 44 bp

21

22 Lab Journal Assignment: Write a formal hypothesis for your expected results –You already wrote an informal prediction based on your phenotype. Now let’s turn that into a formal hypothesis. –If, then statements help. –Example: If gender affects resting heart rate, then males will have a lower resting heart rate than females

23 Standard Using lab techniques, such as DNA extraction, PCR, restriction enzymes and gel electrophoresis to determine the presence or absence of a SNP in a designated gene sequence

24 With this lab, I can… Extract my own DNA from my cheek cells Amplify my DNA using PCR Understand how HAEIII enzyme will identify a SNP in genotype Determine my own genotype using gel electrophoresis

25 Step 4: Gel Electrophoresis 20 µl – DNA marker 10 µl – Undigested DNA 16 µl – Digested DNA

26 Interpreting Gel Results (tt)Non-Taster Strong Taster (TT) Think: What would three bands mean?

27 Example Gel Results

28 Did/Can you… Extract my own DNA from my cheek cells Amplify my DNA using PCR Understand how HAEIII enzyme will identify a SNP in genotype Determine my own genotype using gel electrophoresis

29 Standard Using lab techniques, such as DNA extraction, PCR, restriction enzymes and gel electrophoresis to determine the presence or absence of a SNP in a designated gene sequence

30 2.1.3 Conclusion Questions 1.Explain how the HaeIII enzyme discriminates between the C-G polymorphism in the TAS2R38 gene. 2.Using what you know about genetics, SNPs, and the PTC gene, explain why it is possible for a person to be a “weak taster.” 3.Some studies have shown that PTC “tasters” are less likely to become smokers. Why do you think scientists are seeing this correlation? 4.How can the techniques described in this lab be used to test for human disease genes? Would this type of testing work on every disease with a genetic component? 5.What ethical issues are raised by human DNA typing experiments?

31 Reflection: In lab journal How well does phenotype work to predict genotype? –Use not only your results, but those of the class to answer this question. –Provide evidence from the lab and your knowledge of the TAS2R38 gene and its inheritance pattern to support your answer.


Download ppt "“Using a Single Nucleotide Polymorphism to Predict Bitter Tasting Ability” SNP Lab Instructions."

Similar presentations


Ads by Google