Presentation is loading. Please wait.

Presentation is loading. Please wait.

Mechanisms of solvent tolerance in Pseudomonas putida Juan L. Ramos & Ana Segura, Antonia Rojas, Wilson Terán, M. Trini Gallegos, Estrella Duque.

Similar presentations


Presentation on theme: "Mechanisms of solvent tolerance in Pseudomonas putida Juan L. Ramos & Ana Segura, Antonia Rojas, Wilson Terán, M. Trini Gallegos, Estrella Duque."— Presentation transcript:

1 Mechanisms of solvent tolerance in Pseudomonas putida Juan L. Ramos & Ana Segura, Antonia Rojas, Wilson Terán, M. Trini Gallegos, Estrella Duque

2 Solvent-tolerant microbes are envisaged as powerful tools for: Decontamination of sites heavily polluted with solvents Biotransformations in double-phase systems Biosensors

3 *Inoue and Horikoshi, 1991, Nature 338, Pseudomonas putida, toluene tolerant *Cruden et al., 1992, Appl. Environ. Microbiol. 58, P. putida, p-xylene tolerant *Weber et al., 1993, Appl. Environ. Microbiol. 59, P. putida, styrene tolerant *Ramos et al., 1995, J. Bacteriol. 177, P. putida, toluene tolerant and able to use toluene as the only carbon source

4 XFC1C2BATSIGEDH CH 3 ISP TOL (todC1C2) Ferredoxin TOL (todB) Reductase TOL (todA) NAD + NADH+H + O2O2 CH 3 OH H H toluene cis-toluene dihydrodiol NAD + (todD) NADH+H + CH 3 OH 3-Methylcatechol O2O2 (todE) Ring fission

5 Growth of P. putida DOT-T1E in the presence of organic solvents Solvent log P ow Growth (OD 660 ) n-Decane n-Octane n-Heptane Propylbenzene Diethylphthalate Cyclohexane Ethylbenzene p-xylene Styrene Toluene 1-Heptanol Dimethylphthalate Benzene Chloroform Butanol >2.0 >1.0 <0.1

6 Why are Pseudomonas DOT-T1E and other strains tolerant to toluene? Physical barriers that increase membrane rigidity Biochemical barriers that involve removal of toluene by efflux pumps

7 PHYSICAL BARRIERS (cis -> trans isomerization, Cardiolipin biosynthesis, Fatty acid metabolism) TtgJ Constitutive and inducible Efflux pumps BIOCHEMICAL BARRIERS

8 LB LB+tol(g) +0.3% tol-0.3% tol +0.3% tol

9 log CFU/ml DOT-T1E (wild type) time (minutes)

10 PHYSICAL BARRIERS Cis  trans isomerization of unsaturated fatty acids Biosynthesis of cardiolipin

11 C14:0 C16:1 cis C16:1 trans C16:0 C17:cyclopropane C18:2 cis cis C18:1 cis ol C18:1 cis va C18:1 trans va C18:0 cis/trans saturated/unsaturated LBLB +1%(v/v) toluene

12 actcti metH 182bp TACCT 5´- CATAGGAACTACCTGGTCGGGCGAATATCAGAAGGTGCCGAATCATAACAAA GCTGCGCGGTTTTTAGGCATGTCGCCCATTTGCATGAAAACTGCTCATGTTG GGCGGGTGGAGGCAGCGCAAGGCACCCAGGACGACCAGGCAACAAATCGTGA TGGCTTTCAAGAACCAGGACTTTCCGCACATG-3´ 194bp 5´-TGATCGGGTTGGCTGACCTTTCCGAGTACCTTGCGGTCGGAATGGGTG GGTGGTCTTGATCGATTGCAAAGGGGGCTGCTTTGCAGCCCTTCGCGG GTGAACCCGCTCCTACAACAGGTACGGCGCTGCTCTGAAGGCTGGCGC TGGCCTCTGCACTCGATACGGGCCTCAATGCACCGCCAAGCGCAGGGT ATTCCATG-´3 BglII SphI 2.9 kbp2.4 kbp1.6 kbp  6.9 kbp

13 BglII BamHI BglII 0,57kbp KpnI 0,8 kbp1,5 kbp 1,6 kbp ctiT1 N-terminal region ctiT1 N-terminal region

14 DOT-T1E-P4 Fatty acid Growth conditions LBLB plus heptane C14:0 C16:1,9 cis C16:1,9 trans C16:0 C17:cyclopropane C18:2 C18:1,9 cis ol C18:1,11 cis vac C18:1,11 trans vac C18:

15 Time (hours) Turbidity (OD 660nm)

16 Head group phospholipid composition of P. putida DOT-T1 growing in the absence and in the presence of organic solvents Organic solvent PEPGCL PE PG+CL None Toluene (1% v/v)

17 CL BIOSYNTHESIS TAKES PLACE AT THE EXPENSE OF PG 32P incorporation assays indicates that in the presence of toluene the rate of CL synthesis is twice as high as in the absence of the solvent. The Pseudomonas putida cls gene has been cloned, mutated in vitro and inactivated in vivo by homologous recombination. The response of a cls mutant to toluene shocks has been analyzed. Under a any growth conditions a solvent shock resulted in a survival that is two orders of magnitud below that of the wild-type strain.

18 Conclusions The main alterations in response to toluene observed in Pseudomonas putida are: cis -> trans isomerization of unsaturated fatty acids and increase in the level of cardiolipin. A cti mutant of Pseudomonas putida DOT-T1 exhibited a delay in growth in response to solvents, but it was as tolerant as the wild- type to sudden solvent shocks. A cls mutant of Pseudomonas putida DOT-T1 is more sensitive to solvent shocks than the wild-type strain.

19 Solvents Fatty acids saturatedcis-isomertrans-isomer

20 EFFLUX PUMPS

21 Incorporation of 1,2,4-[ 14 C]-trichlorobenzene into membranes of P. putida cells Conditions 14 C/mg cell protein Untreated FCCP-treated Solvent tolerance is an energy-dependent process

22 Isolation of Tn5 solvent-sensitive mutants of Pseudomonas putida DOT- T1E 1) Mutants that simultaneously exhibited increased sensitivity to solvents and antibiotics (ampicillin, chloramphenicol and tetracycline) 2) Mutants that exhibited increased sensitivity to solvents but retained the wild-type level of resistance to ampicillin, chloramphenicol and tetracycline

23 log CFU ml -1 Time (min) DOT-T1EKT-2440DOT-T1E-18

24 Incorporation of 1,2,4-[ 14 C]-trichlorobenzene into membranes of P. putida cells Culture Conditions 14 C/mg cell protein Wild-type DOT-T1E18 LB LB+ toluene

25 ttgVttgG ttgH ttgI ttgW ttgTttgD ttgE ttgF ttgRttgA ttgB ttgC ACGT -tol+tol A G T C

26 TtgB TtgC TtgA Outer membrane Periplasmic space Inner membrane CH ?

27 ttgVttgG ttgH ttgI ttgW ttgTttgD ttgE ttgF ttgRttgA ttgB ttgC ACGT -tol+tol A G T C

28 Viable cells (log CFU ml -1) Time (min) 9 5 DOT-T1E DOT-T1E DOT-T1E-18DOT-T1E TtgABC TtgDEFTtgGHI Wild-type

29 ttgVttgG ttgH ttgI ttgW ttgTttgD ttgE ttgF ttgRttgA ttgB ttgC ACGT -tol+tol A G T C

30

31 GGAATATACTTACATTCATGGTTGTTTGTAAGGAATATACTTACATTCATGGTTGTTTGTAA TTTACAAACAACCATGAATGTAAGTATATT TTTACAAACAACCATGAATGTAAGTATATT P ttgABC P ttgR TtgR (nM) P ttgABC -P ttgR DNA (10nM) U B1B1 B2B2

32 SubstratesTtgABCTtgDEFTtgGHI Toluene Styrene m-xylene Propylbenzene Ethylbenzene Tetracycline Ampicillin Chloramphenicol Gentamicin Nalidixic Carbenicillin

33 Viable cells (log CFU ml -1) Time (min) 9 5 DOT-T1E DOT-T1E DOT-T1E-109

34 Expression of solvent-tolerant efflux pumps in the wild-type and the TtgJ mutant background StrainFusion  -galactosidase (Units ) -Toluene+Toluene Wild-type P ttgA :lacZ P ttgD :lacZ P ttgG :lacZ DOT-T1E-109 P ttgA :lacZ P ttgD :lacZ P ttgG :lacZ

35 Incorporation of 1,2,4-[ 14 C]-trichlorobenzene into membranes of P. putida cells Culture Conditions 14 C/mg cell protein DOT-T1-109 Wild-type LB LB+ toluene

36 tolueno

37 T1E T1E +tol 109+tol Incorporation of 13 C-acetate in fatty acids Relative increase of 13 C

38 Fatty acid Acyl- CoA synthetase motif ATP-binding P-loop motif The TtgJ protein The TtgJ protein exhibits 38-45% similarity with the FadD protein of several microorganisms, i.e. Pseudomonas putida, Pseudomonas aeruginosa, Bacillus subtilis, Mycobacterium tuberculosis, etc The TtgJ protein exhibits 42% identity with an orf of Pseudomonas aeruginosa that probably encodes for an acetyl-CoA synthetase The TtgJ protein does not complement an E.coli fadD mutant

39 T1E T1E +tol 109+tol Incorporation of 13 C in proteins Relative increase of 13 C

40 Signal-CoA Signal -X TtgJ Estimulates transcription of ttgDEF/ttgGHI Inhibits biosynthesis of phospholipids

41 Conclusions Biosynthesis of fatty acids is essential for solvent tolerance. In a ttgJ mutant background in which fatty acid biosynthesis is impeded, blebs are formed and cells become extremely solvent sensitive. Three efflux pumps are involved in solvent tolerance. Two of the pumps (TtgDEF and TtgGHI) are overexpressed in a mutant background deficient in the TtgJ protein. The TtgJ protein, that exhibits features of acyl-CoA synthases, might function as a sensor system for alarmone molecules produced in response to the presence of solvents

42 Solvent-tolerant bacteria allowing a broader performance of biotransformations of organic compounds in two-phases fermentation systems EEZ

43 XFC1C2BATSIGEDH CH 3 ISP TOL (todC1C2) Ferredoxin TOL (todB) Reductase TOL (todA) NAD + NADH+H + O2O2 CH 3 OH H H toluene cis-toluene dihydrodiol NAD + (todD) NADH+H + CH 3 OH 3-Methylcatechol O2O2 (todE) Ring fission

44 EEZ K F B T O Tn4653 I N X K Tn4651 B H F V D xylR xylS D A E E I J C P meta A D G Q Fupper I E H A G S G C J C M R J L B H pWW0 XhoI EcoRI HindIII Tra/Rep tnpT res tnpS tnpA (Tn4651 ) tnpA (Tn4653 ) 117 kb Operón H N Plasmid pWWO

45 xyl U W C M A B N Pu CH 3 xylMA xylB R1R1 R2R2 CH 2 OH R1R1 R2R2 CHO R1R1 R2R2 xylC COOH R1R1 R2R2 Pm xylX Y Z L E G F J Q K I H COOH R1R1 R2R2 xylXYZ HOOC R1R1 R2R2 OH H R1R1 R2R2 xylL OH CO 2 OH R1R1 R2R2 COOH xylE EEZ O OH R2R2 COOH R2R2 xylG xylH xylI R2R2 COOH O O R2R2 O CO 2 R 1 COOH xylF OH xylJ xylK CH 3 COCOOH R 2 CH 2 CHO +

46 OH COOH O OH XYZ+LEF... H Krebs cycle CH 3 COOH MA B C xyl S Ps2Ps1 + Pm xylX Y Z L E G F J Q K I H Methyl-benzoate xylene - - IHF   54  70 /  38  70   54 HU  70 xyl U W C M A B N Pu - Pr1Pr2  70 R xyl EEZ Toluene degradation pathway encoded in plasmid pWWO

47 xyl U W C M A B N Pu Pm xylX Y Z L E G F J Q K I H EEZ Catechol and methylcatechol bioproduction CH 3 R1R1 R2R2 OH R1R1 R2R2 xylCMABN xylXYZL xylE pWW0 Sm

48 xyl U W C M A B N Pu CH 3 R1R1 R2R2 xylMA xylB CH 2 OH R1R1 R2R2 CHO R1R1 R2R2 xylC COOH R1R1 R2R2 Pm xylX Y Z L E G F J Q K I H OH R1R1 R2R2 xylE EEZ R 1 COOH COOH R1R1 R2R2 xylXYZ HOOC R1R1 R2R2 OH H xylL CO 2 OH R1R1 R2R2 COOH O OH R2R2 COOH R2R2 xylG xylH xylI R2R2 COOH O O CO 2 xylF R2R2 COOH O OH xylJ xylK CH 3 COCOOH R 2 CH 2 CHO + CH 3 R1R1 R2R2 COOH R1R1 R2R2 Nitrobenzoates synthesis

49 EEZ Nitrobenzoates synthesis CH 3 xylMA xylB CH 2 OH CHO xylC COOH CH 3 NO 2 CH 3 NO 2 xylUWCMABN COOH NO 2 COOH NO 2 xyl S Ps 1-2 Pm xylX Y Z L E G F J Q K I H xyl U W C M A B N Pu Pr 1-2 xylR Toluenes Benzyl-alcohol p-chlorobenzaldehyde p-nitrotoluene m-nitrotoluene STOP

50 xyl U W C M A B N Pu CH 3 xylMA xylB R1R1 R2R2 CH 2 OH R1R1 R2R2 CHO R1R1 R2R2 xylC COOH R1R1 R2R2 Pm xylX Y Z L E G F J Q K I H EEZ COOH R1R1 R2R2 xylXYZ HOOC R1R1 R2R2 OH H R1R1 R2R2 xylL OH CO 2 OH R1R1 R2R2 COOH xylE O OH R2R2 COOH R2R2 xylG xylH xylI R2R2 COOH O O R2R2 O CO 2 R 1 COOH xylF OH xylJ xylK CH 3 COCOOH R 2 CH 2 CHO + CH 3 R1R1 R2R2 CHO R1R1 R2R2 p- and m-nitrobenzaldehydes synthesis

51 xyl U W C M A B N Pu CH 3 xylMA xylB R1R1 R2R2 CH 2 OH R1R1 R2R2 CHO R1R1 R2R2 xylC COOH R1R1 R2R2 EEZ CH 3 R1R1 R2R2 CHO R1R1 R2R2 p- and m-nitrobenzaldehydes synthesis xylC P trc xylMAB MiniTn5

52 xyl U W C M A B N Pu CH 3 xylMA xylB R1R1 R2R2 CH 2 OH R1R1 R2R2 CHO R1R1 R2R2 xylC COOH R1R1 R2R2 Pm xylX Y Z L E G F J Q K I H COOH R1R1 R2R2 xylXYZ HOOC R1R1 R2R2 OH H R1R1 R2R2 xylL OH CO 2 xylE EEZ OH R1R1 R2R2 COOH O OH R2R2 COOH R2R2 xylG xylH xylI O R2R2 COOH O R2R2 O CO 2 R 1 COOH xylF OH xylJ xylK CH 3 COCOOH R 2 CH 2 CHO + CH 3 R2R2 R1R1 G OH R1R1 R2R2 COOH O xylG xylF

53 xyl U W C M A B N Pu CH 3 H R2R2 Pm xylX Y Z L E G F J Q K I H EEZ OH H R2R2 COOH O NH 3 COOH NHNH NHNH CO 2

54 Conclusions Pseudomonas putida exhibits three efflux pumps involved in solvent tolerance. Some of these pumps are expressed constitutively and other are regulated in response to the presence of solvents The level of expression of each of the efflux operons is regulated by a repressor that binds at the –10 region and prevents access of the RNA polymerase to the promoter. In addition to the repressor global and specific positive regulators are involved in the control of the expression of the efflux pump operons.


Download ppt "Mechanisms of solvent tolerance in Pseudomonas putida Juan L. Ramos & Ana Segura, Antonia Rojas, Wilson Terán, M. Trini Gallegos, Estrella Duque."

Similar presentations


Ads by Google