Presentation is loading. Please wait.

Presentation is loading. Please wait.

ITR 5’ITR 3’ ORF codant la transposase (Tnp) Hsmar1: miHsmar1 (80 pb)

Similar presentations

Presentation on theme: "ITR 5’ITR 3’ ORF codant la transposase (Tnp) Hsmar1: miHsmar1 (80 pb)"— Presentation transcript:

1 ITR 5’ITR 3’ ORF codant la transposase (Tnp) Hsmar1: miHsmar1 (80 pb)

2 b. PositionTA location in ccdB 1170-tggctgtgTATCAGG/clone1/CCTGATAtaagggag (ccdB 3’UTR) 1189-ctgacattTATCAGG/clone2/CCTGATAtattcccc (ccdB stop codon) 1211-catcaggtTATCAGG/clone3/CCTGATAatggcgtt (ccdB ORF) 1471-ctcttttaTATCAGG/clone4/CCTGATAggtgtaaa (ccdB ORF) 1477-tataggtgTATCAGG/clone5/CCTGATAaaccttaa (ccdB ORF) ccdB + KanaR pUC ori a. ccdB + KanaR pUC ori AmpR lacZ’ mini-Mos1 pDONR221-CmR - ITR3pA Random Integrations in the pDONR221-CmR - Selection of the transposition events in ccdB- by tranfecting in DH5  bacteria and plating on LB-kanamycin petri dishes

3 a. 1 87 113 57 18130 74 35147 91 52164 108 70182 126 87 199 143 123456123456 d. 3’ITR (TA)TCAGGTGTACAAGTATGAAATGTCGTTT 5’ITR (TA)cCAGGTGTACAAGTAgGgAATGTCGgTT 104 107 b. 1 2 3 4 5 6 Free ITR Complexes Probes 0.10 0.12 0.14 0.16 0.18 0.20 0.22 507090110130150 Probe Center Rf c.

4 TA 5’ * Non Transferred strandTransferred strand TA 5’ * T A T C A G G T G T A C A A G T A T G A A A T G T C G T T t c T g g a t g a t c g C T A G T C C A A T G T T C A T A C T T T A C A G C A A A a g A c c t a c t a g c t G+A PEC1 SEC2 G+A PEC1 SEC2 5’ gaactagtggatc TA TCAGGTGTACAAGTATGAAATGTCGTTTgatc 3’ (NT) 3’ cttgatcacctag AT AGTCCACATGTTCATACTTTACAGCAAActag 5’ (T) a. b.

5 + 5’ nnnTAT +1 C +2 A +3 GGTGT… 3’ (NT) 3’ nnnATA +1 G +2 T +3 CCACA… 5’ (T)       + Mos1 5’ nnnTAA +1 C +2 A +3 GGTTG… 3’ (NT) 3’ nnnATT +1 G +2 T +3 CCAAC… 5’ (T) * * * Himar1 5’ nnnTAT +1 T +2 A +3 GGTTG… 3’ (NT) 3’ nnnATA +1 A +2 T +3 CCAAC… 5’ (T) * * * Hsmar1

6 d. a. b. c.

7 Mobilité des Packs miHsmar1 Question caduque

8 Evolution du projet dans Modulome Fabriquer un outil pour inventorier les miHsmar1 dans les génomes de primates

Download ppt "ITR 5’ITR 3’ ORF codant la transposase (Tnp) Hsmar1: miHsmar1 (80 pb)"

Similar presentations

Ads by Google