Presentation is loading. Please wait.

Presentation is loading. Please wait.

8 seqs/day 96 seqs/2 hrs Bioinformatics for Genomics.

Similar presentations


Presentation on theme: "8 seqs/day 96 seqs/2 hrs Bioinformatics for Genomics."— Presentation transcript:

1 8 seqs/day 96 seqs/2 hrs Bioinformatics for Genomics

2 TAGAGCATCGATCGATGCTGCAGATGATGCTAGCATCGGCTAGGCGACG ATCTCGTAGCTA ATCTCGTAGCTAGCTACGACGTCTA ATCTCGTAGCTAGCTA ATCTCGTAGCTAG ATCTCGTAGCTAGC ATCTCGTAGCTAGCT ATCTCGTAGCTAGCTAC ATCTCGTAGCTAGCTACG ATCTCGTAGCTAGCTACGA ATCTCGTAGCTAGCTACGAC ATCTCGTAGCTAGCTACGACG ATCTCGTAGCTAGCTACGACGT ATCTCGTAGCTAGCTACGACGTC ATCTCGTAGCTAGCTACGACGTCT ATCTCGTAGCT A G C T A C G A C G T C T A

3 Random base calling at the beggining or the end of read (Phred < 10) Trimming (trim or trim_alt algorithms) Phred does the base calling chromatogram acgatctcgctagctgctactgtagccgcgattattcgcgatctacgtatatcgcgatcgatc Each base has assigned a chance of failure 1% = 0,01 = = Phred 20 Base calling & trimming

4 Start End

5 Goal: To document the presence of transcripts in a transcriptome [otorrin... in portuguese] EST = Expressed Sequence Tag Partial sequencing of transcripts in EST genome projects actgatcatctcgctgatgcgatc work


Download ppt "8 seqs/day 96 seqs/2 hrs Bioinformatics for Genomics."

Similar presentations


Ads by Google