Presentation is loading. Please wait.

Presentation is loading. Please wait.

Environmental DNA ‘eDNA’ Karen Mock & Torrey Rodgers Utah State University.

Similar presentations


Presentation on theme: "Environmental DNA ‘eDNA’ Karen Mock & Torrey Rodgers Utah State University."— Presentation transcript:

1 Environmental DNA ‘eDNA’ Karen Mock & Torrey Rodgers Utah State University

2 Noninvasive Genetic Sampling

3 Species Identification Not individual ID Presence/Absence Data Assay designed to ID a particular species or group of species Requires comparison with known reference sequences Often a mitochondrial genome target sequence e.g. CTATACGGGTCNGCCCTATTAGTCATTTTATCAT CATATTTCCAAGGTATTCTATTCCCTTCACCCAA CCGACTAATTAATAACCGCCTAGTCTCACTACAC AATGACTAGTACAACTAAATCAAAACAAATACG GAA

4

5 eDNA is DNA that can be extracted from environmental samples without capturing or even seeing the target organism. DNA may be cellular or extracellular Substrate may be water, snow, soil, vegetation… Target may be single species, a small number of species, or everything present (meta-barcoding).

6 How it Works Field Lab Uses quantitative PCR (qPCR) to detect certain species; can be more sensitive and more specific than conventional PCR

7 Taxon-specific PCR primers and probe to detect a particular DNA sequence in a mixture of DNA molecules from different sources.

8

9

10 eDNA applications Species distribution especially for rare, endangered, or cryptic species Early detection of invasive species Relative density

11 Species distributions Especially useful for rare, endangered, or cryptic species SpeciesLocationCitation Rocky Mountain tailed frog Idaho giant salamanders IdahoGoldberg et al Pilliod et al Eastern HellbenderIndiana, Missouri, Ohio, Kentucky, North Carolina Olsen et al Santas et al Spear et al Bull TroutMontanaWilcox et al Brook TroutMassachusettsJane et al Great Crested NewtUnited KingdomBiggs et al Weather LoachDenmarkSigsgaard et al CetaceansDenmarkFoote et al Spadefoot Toad, Great Crested Newt, Weather Loach, White-faced darter, Eurasian otter Throughout EuropeThomsen et al Chinook SalmonUpper Columbia River BasinLaramie et al. 2015

12 Invasive Species Detection Early detection of invasive species before they become established eDNA may be able to detect invasive species prior to traditional methods SpeciesLocationCitation Bighead Carp (Asian carp)Great lakes regionJerde et al. 2011, 2013 Mahon et al Burmese PythonFloridaPiaggio et al American Bull FrogFranceDejean et al New Zealand Mud SnailIdahoGoldberg et al Zebra MusselMichiganEgan et al BluegillJapanTakahara et al Red Swamp CrayfishFranceTreguier et al Didymo (Rock Snot)New Zealand, Western US Cary et al Mock, Rodgers, Olsen Unpublished

13 Relative Density The quantity of eDNA (from qPCR) in a sample should correlate with species biomass and thus density Klymus et al Fig. 2 Combined scatter plots of eDNA shedding rate against biomass of fish in tanks.

14 Relative Density Pilliod et al eDNA vs. traditional kicknet surveys

15 Relative Density In fish, eDNA shedding rates may vary with diet (Klymus et al. 2015) More research needed to determine eDNA shedding rates, across species and environmental conditions Such factors may bias the link between biomass and relative density More empirical lab and field studies needed compare eDNA quantities and relative density

16 Sampling Considerations eDNA persistence/degradation Movement of eDNA in lotic systems Cross contamination and false positives

17 eDNA persistence/degradation In fresh water, eDNA degrades, and is no-longer detectable, in days or weeks (at longest 58 days, Strickler et al. 2015) Thus eDNA detection should be indicative of contemporary species presence Fig.1. Time-dependant changes in eDNA concentration after fish removal. Maruyama et al 2014

18 eDNA persistence/degradation eDNA degradation is influenced by temperature, UV and pH Environments favorable for microbe activity increase rate of eDNA degradation (Strickler et al. 2015) eDNA may persist much longer, (from months to hundreds of years) in aquatic sediments (Turner at al. 2015).

19 Movement of eDNA in lotic systems In lotic systems, is eDNA detection indicative of local presence, or presence upstream instead? Low flow 4-7 L/s High flows >10 L/s Jane et al Controlled experiment with caged trout eDNA still detectable at 239m from cage site

20 Movement of eDNA in lotic systems In two invertebrate species, eDNA was detectable up to nearly 12 kilometers from the source

21 Cross contamination It is very important to avoid cross contamination in the field and lab to avoid false positives Careful handling of samples (changing gloves between samples) Bleach decontamination of collection equipment between sites Inclusion of field negative controls to monitor for contamination

22 Novel eDNA applications Moving eDNA beyond aquatic environments to terrestrial environments eDNA from browsed vegetation eDNA from drinking water eDNA from snow tracks eDNA from invertebrate “samplers” eDNA from salt licks? Any other ideas?

23 Used eDNA from saliva on browsed twigs to identify ungulate species (moose, roe deer, fallow deer and red deer) Found the DNA could be amplified up to 12 weeks later Could be used to study browsing habits of different species without direct observation Could be used to detect rare ungulates

24 eDNA from drinking water eDNA sampling of watering holes could be used to detect species that drank there We were able to recover and sequence coyote eDNA from drinking water at the Coyote research facility Could be especially useful to survey desert species e.g. kit foxes in S. Utah

25 eDNA from Snow Tracks eDNA extracted from snow tracks of Polar bear

26 Used mammalian DNA in blood collected from leeches 21 of 25 leeches collected in Vietnam contained mammal DNA from 6 different species This included the recently discovered (in 1997) and extremely rare Truong Son munjtac 2012

27 Used DNA from carrion flies, flies which feed on dead animals and wounds on live animals and scat Of 115 flies collected in Africa and Madagascar, 46 contained mammal DNA from 20 different species Included small and large mammals, canopy living mammals and bats

28 Carrion flies exist world-wide, and are easy to trap This tool could greatly improve upon surveys of mammal diversity

29 Advantages of eDNA Does not require sighting or handling of target species Does not require taxonomic expertise or animal handling skills Generally has higher detection probabilities and greater sensitivity than traditional sampling techniques Is often (but not always) more economical than traditional sampling techniques Once an assay is established, samples are very inexpensive to run (e.g. ~$20 per sample for multiples of 48 samples) Multiple assays (different species queries) can be run on the same samples

30 Limitations of eDNA No detection of individuals Primer/probe designs are species-specific and require considerable up-front investment Pilot work is necessary to understand variance in detectability for different species and systems

31 Recent Publications The journal Biological Conservation has an upcoming special issue dedicated to eDNA: about-edna.html

32 Labs USU Molecular Ecology Lab assay development, pilot testing service lab billing linkage to graduate/ undergrad projects Karen Mock Pisces Molecular private company in Boulder, CO excellent choice for high throughput work for established assays


Download ppt "Environmental DNA ‘eDNA’ Karen Mock & Torrey Rodgers Utah State University."

Similar presentations


Ads by Google