Presentation is loading. Please wait.

Presentation is loading. Please wait.

Pasha Baranov "NGS Data after the Gold Rush“ Norwich, UK, May 2014

Similar presentations


Presentation on theme: "Pasha Baranov "NGS Data after the Gold Rush“ Norwich, UK, May 2014"— Presentation transcript:

1 Pasha Baranov "NGS Data after the Gold Rush“ Norwich, UK, May 2014
From Big Data to Relevant data: Ribo-seq and its applications Pasha Baranov "NGS Data after the Gold Rush“ Norwich, UK, May 2014 time Porridge volume, log

2 ? What to sequence? RNA-seq Lung cancer
Genetics: up to 2.4 higher chance than general population. 80-90% of lung cancer cases attributed to smoking. DNA RNA-seq Median age of lung cancer occurrence in US is 70 years. RNA ? Protein

3 Ribosomal profiling (ribo-seq)
Ingolia et al (2009) Science 324: Lysis, RNA digestion

4 Ribosomal profiling (ribo-seq)
Ingolia et al (2009) Science 324: Lysis, RNA digestion Density gradient or cushion separation

5 Ribosomal profiling (ribo-seq)
Ingolia et al (2009) Science 324: Lysis, RNA digestion Density gradient or cushion separation Decircularization Circularization RT PCR Adaptor ligation Differential gene expression analysis Sequencing Alignment to a reference sequence

6 mRNA level is only approximation of protein synthesis
Immediate response to oxidative stress (1 hour) Andreev et al 2014 submitted

7 How do you know what is translated?
CTGGAAGAAGTAAACGCCGAGCTGGAACAGCCGGATGTCTGGAACGAACC G R S K R R A G T A G C L E R T Frame 1 L E E V N A E L E Q P D V W N E P Frame 2 W K K * T P S W N S R M S G T N P Frame 3

8 Triplet periodicity CAGCTAGTGCGTGCTGTC

9 Triplet periodicity CAGCTAGTGCGTGCTGTC

10 Triplet periodicity CAGCTAGTGCGTGCTGTC

11 Triplet periodicity CAGCTAGTGCGTGCTGTC

12 Triplet periodicity CAGCTAGTGCGTGCTGTC

13 Triplet periodicity CAGCTAGTGCGTGCTGTC

14 Triplet periodicity N+1 N+2 N+3

15 Switches between reading frames can be seen on ribosome profiles
Human Antizyme 1 mRNA Michel et al 2012 Genome Res 22:

16 uORFs & nORFs Michel et al 2012 Genome Res 22:

17 GWIPS-viz

18 Acknowledgments Dual coding: GWIPS-viz team: Oxidative stress work:
Audrey Michel University College Cork: Choudhury, Atkins Berkley: Ingolia Cambridge: Firth GWIPS-viz team: Audrey Michel Gearoid Fox Patrick O'Connor Stephen Heaphy Paddy Mullan Claire Donohue Romika Saini Zena Abbas Oxidative stress work: Dmitry Andreev Patrick O’Connor Moscow State University: Terenin, Dmitriev, Shatsky Trinity College Dublin: Kenny, Fahey, Cormican, Morris Financial resources:


Download ppt "Pasha Baranov "NGS Data after the Gold Rush“ Norwich, UK, May 2014"

Similar presentations


Ads by Google