Presentation is loading. Please wait.

Presentation is loading. Please wait.

From Big Data to Relevant data: Ribo-seq and its applications Pasha Baranov "NGS Data after the Gold Rush“ Norwich, UK, May 2014 time Porridge volume,

Similar presentations


Presentation on theme: "From Big Data to Relevant data: Ribo-seq and its applications Pasha Baranov "NGS Data after the Gold Rush“ Norwich, UK, May 2014 time Porridge volume,"— Presentation transcript:

1 From Big Data to Relevant data: Ribo-seq and its applications Pasha Baranov "NGS Data after the Gold Rush“ Norwich, UK, May 2014 time Porridge volume, log

2 Genetics: up to 2.4 higher chance than general population. What to sequence? Lung cancer 80-90% of lung cancer cases attributed to smoking. Median age of lung cancer occurrence in US is 70 years. DNA RNA Protein RNA-seq ?

3 Ribosomal profiling (ribo-seq) Ingolia et al (2009) Science 324: Lysis, RNA digestion

4 Ribosomal profiling (ribo-seq) Lysis, RNA digestion Density gradient or cushion separation Ingolia et al (2009) Science 324:

5 Ribosomal profiling (ribo-seq) Lysis, RNA digestion Density gradient or cushion separation Adaptor ligation RT PCR Circularization Decircularization Sequencing Alignment to a reference sequence Differential gene expression analysis Ingolia et al (2009) Science 324:

6 mRNA level is only approximation of protein synthesis Immediate response to oxidative stress (1 hour) Andreev et al 2014 submitted

7 How do you know what is translated? CTGGAAGAAGTAAACGCCGAGCTGGAACAGCCGGATGTCTGGAACGAACC G R S K R R A G T A G C L E R T Frame 1 L E E V N A E L E Q P D V W N E P Frame 2 W K K * T P S W N S R M S G T N P Frame 3

8 Triplet periodicity CAGCTAGTGCGTGCTGTC

9 Triplet periodicity CAGCTAGTGCGTGCTGTC

10 Triplet periodicity CAGCTAGTGCGTGCTGTC

11 Triplet periodicity CAGCTAGTGCGTGCTGTC

12 Triplet periodicity CAGCTAGTGCGTGCTGTC

13 Triplet periodicity CAGCTAGTGCGTGCTGTC

14 Triplet periodicity N+1 N+2 N+3

15 Switches between reading frames can be seen on ribosome profiles Human Antizyme 1 mRNA Michel et al 2012 Genome Res 22:

16 uORFs & nORFs Michel et al 2012 Genome Res 22:

17 GWIPS-viz

18 Acknowledgments GWIPS-viz team: Audrey Michel Gearoid Fox Patrick O'Connor Stephen Heaphy Paddy Mullan Claire Donohue Romika Saini Zena Abbas Oxidative stress work: Dmitry Andreev Patrick O’Connor Moscow State University: Terenin, Dmitriev, Shatsky Trinity College Dublin: Kenny, Fahey, Cormican, Morris Dual coding: Audrey Michel University College Cork: Choudhury, Atkins Berkley: Ingolia Cambridge: Firth Financial resources:


Download ppt "From Big Data to Relevant data: Ribo-seq and its applications Pasha Baranov "NGS Data after the Gold Rush“ Norwich, UK, May 2014 time Porridge volume,"

Similar presentations


Ads by Google