1. Alternative Splicing of Genes in Early Stage of Neural Differentiation Dr. A.H.M. Khurshid Alam Associate Professor, Department of Pharmacy, Rajshahi University 1

2. Outline Part I. Chapter -I. General Introduction Part II. Chapter-II~IV. Experimental and Discussion Part III. Chapter-V. Summary 2

3. Chapter-I General Introduction 3

4. Most of Genes are Fragmented in Eukaryotes Genes are fragmented in human genome, avr. 10 exons Exons: avr. 145 bp length and mainly responsible for protein Introns: avr. 3,365 bp length, non protein coding region, and removed by splicing 4

5. Splicing Connects Two Exons Molecular Biology of the CELL, 5 th edition A 5

6. Many Isoforms From a Single Gene by Splicing eg. Drosophila DSCAM (Down Syndrome Cell Adhesion Molecule) gene Each single gene generates a single transcript (protein) Human genome would have almost 100,000 genes which produce at least 100,000 proteins After completion of human genome in 2003, researchers found app. 25,000 genes but protein numbers were 100,000 Alternative splicing This basic disproportion is of 1 gene 1 protein 1 gene at least 4 proteins 1 DSCAM gene 38,000 dscam isoforms 6

7. Retained intron Alternative 5 ʹ splice sitesAlternative 3 ʹ splice sites Skipping exon Mutually exclusive exons Alternative promoters Alternative poly-A sites Types of Alternative Splicing Li Q et al., Nature Reviews Neuro.; 2007  Five types of splicing patterns such as intron retention, alternative 5' and 3' splice site selections, skipping exon, and mutually exclusive exon  In addition, two more splicing patterns eg. alternative promoters and alternative poly-A sites are also present  70% of human genes are alternatively spliced  Exons are represented by boxes and introns by solid lines 7

8. Exon2Exon3 Exon2Exon3 Exon1 Alternative splicing Alternative Splicing Generates Multiple Isoforms eg. skipping exon Exon3 Exon1 8

9. Regulation of Alternative Splicing  Two important factors such as cis-acting elements and trans-acting factors are necessary for splicing regulation  Cis-acting elements, eg. exonic and intronic splicing enhancers (ESE and ISE) and silencers (ESS and ISS) are present in exon and intron  Trans-acting factors, serine-arginine-rich proteins (SR proteins), SR-like proteins and heterogeneous nuclear ribonucleoproteins (hnRNPs) Black et al., Annual Reviews of Biochem.; 2003 9

10. P19 Cells and Differentiation  P19 cells are derived from a teratocarcinoma of mouse embryo  The genetic composition of the cells can be easily manipulated  It is easy to grow and maintain in the undifferentiated state  It can efficiently be induced to differentiate into many cell types  RA and cell aggregation can induce to differentiate into neurons & glial cells 1 µM RA 4 day Immature P19 cells Aggregated P19 cells Neural cells Glial cells 10

11. Reason And Objective of This Study  The early responses of transcriptional regulation in neural differentiation of P19 cells are known a bit  Nothing is known about the early response of alternative splicing in neural differentiation of P19 cells  To investigate the machinery of splicing factors during differentiation Reason Objective  Regulation of splicing mechanism by splicing factors is known a bit but no report by alternatively spliced isoforms during differentiation  To investigate the effects of RA and cell aggregation on alternative splicing in the early stage of neural differentiation of P19 cells (Chapter-II ) (Chapter-IV)  To clarify the biological function of alternative splicing in early stage of neural differentiation of P19 cells (Chapter-III)  There is no report about the biological function of alternative splicing in early stage of neural differentiation 11

12. Experimental and Discussion Chapter-II : Screening Alternatively Spliced Genes to Identify Early Responses in Neural Differentiation of P19 Cells Chapter-III : Biological Function of Alternative Splicing in Neural Differentiation of P19 Cells Chapter-IV : Study Mechanism of Alternative Splicing 12

13. Chapter-II Screening Alternatively Spliced Genes to Identify Early Responses in Neural Differentiation of P19 cells 13

14. P19 Cells and Neural Induction P19 cells: Embryonic carcinoma (EC) cell line derived from mouse Retinoic acid (RA) & Cell aggregation Differentiate into neurons & glial cells Neural differentiation by RA Differentiation (cells are replated as single cell suspension and are left to differentiate into neurons and glial cells ) for 10 days Induction for 4 days by RA treatment RA and/or cell aggregation To know whether RA and/or cell aggregation have independent effect in early stage of neural differentiation of P19 cells 14

15. Teramoto et al., Oncology Report; 2005 So Far Published Results  Many gene transcripts are expressed in different cells including P19 cells during neural differentiation  Some of them are up-regulated or down-regulated during neural differentiation  Up-regulation or down-regulation of gene transcripts are based on RA treatment and/or cell aggregation Takeyama et al., Biochem. Biophy. Res. Comm.; 1996 15

16. Reason And Objective of This Study  There has been no report about the early responses for alternative splicing in P19 cells during neural differentiation  To find out the alternatively spliced isoforms which have early responses in neural differentiation of P19 cells  To test whether these early responses of isoforms are RA and/or cell aggregation dependent Reason Objective  RA alone changes alternative splicing of some genes in different cells but nothing is known in P19 cells  There has been no report about the effect of cell aggregation on alternative splicing in cells (including P19 cells) and tissues 16

17. Experimental Methods (Chapter-II&III) P19 cells +RA+Aggr. Collect Total RNAs RT-PCR Densitometry -RA+Aggr. +RA-Aggr. -RA-Aggr. PAGE Sequencing 17

18. List of Tested Genes and Their Primers GenesPrimers NameSequences (5' 3')Annealing temp ˚C No. of cycles 5-HTR3-A 5-HTR3-AE8S 5-HTR3-AE9AS GGCACCTGGTCCTAGACAGA GAGGTAGCCCTCTTCCACCA 5830 mHuC mHuC E6S mHuC E7AS TTTGCTCAATATGGCCTACG TTGTACACGAAGATGCACCAG 5735 RBM25 RBM25E3S RBM25E6AS AGAGGGCCGCGAAGACAGTA GGAGGGCGATTCAAATGAG 5830 RBM25E 8S RBM25E10AS TGATGAAAATTGTGGCCCTA GCCTTTGTCTTGGCATCAAC 58 RBM25ETer. 1S RBM25ETer. 1AS RBM25ETer. 2AS CCCGAGAGATCAGCAAATTC GAACAATTAGCAATGGCCACTAT TCCCTTTCACGATCTCTGCT 6030 MAPK12 MAPK12E4S MAPK12E7AS CATGAAGCATGAGACCCTGA CCGGGTTACCACATATCCTG 5532 ACTN1 ACTN1EF1aS ACTN1EF2AS CGCCTCTTTCAACCACTTTG AGAGTTTGCCCAAATCATGA 6027 LGI1 LGI1E1S LGI1I2AS LGI1E2AS LGI1E3AS GCACCGTTCCTCCTGATGT ATACATGCCATATT GTTCTTGGGCACCGACTTAG CACATCAAGGAGTTCGACGTA 6026 LGI1E5S LGI1E6AS TCAAAGGCCTGGATTCCTTA ATTCCACCAGCCACTTCAAC 6026 LGI2 LGI2E1S LGI2E2AS CCACTTGCAGCTGTACCAAG GGAAAACATTCGGTCCTTGA 5828 LGI2E4S LGI2E6AS CCTCCGTGACCTGACTCAC GTCAAGCTGGTCACTTCGTT 5828 LGI2E6S LGI2E7AS CTTAAGGGGTAATAAATTTGAATGTGA CGTTCTTGGAGTTGAACGTG 6025 LGI3 LGI3E1S LGI3E1AS LGI3E3AS AGTAGTTGCGGTCCCAGTTC CCTCTGAACAGGTTCTTG GAAGGCTCCATCCTGGATCT 6025 LGI4 LGI4E1S LGI4E2AS LGI4E3AS TCCTGCTCCAAGGAGAACAC GTGCAATGACGGCATCTTTA ATGAAGGCATCACCCTCAAT 6030 LGI4E6S LGI4E7AS LGI4E8AS CTGCCGTTGCTCAGATACAA GTTGAGGCCAGCTTGAACTT TGTGAGGTTCCCCCTGATAG 6030 CUGBP2 CUGBP2E11S CUGBP2E12AS GAGCCACTGTCGGATTGAAT CTGAATGGAGGACTTGGCGC 6030 CUGBP2E13S CUGBP2E15AS CACTGCCCACTTTGTACAGC CTGATCCTAACCCCAGAAGC 6028 CUGBP1 CUGBP1RRM3 CUGBP1Ter GCAGAGTATTGGTGCTGCTG GTCTCAGAGGGGAGCACTCA 6028 PTB PTBE7S PTBE9AS GCATCGACTTCTCCAAGCTC AGGTGCTGGGAATTCTGTCC 6028 Fgf8 Fgf8E2S Fgf8E3AS TGTTGCACTTGCTGGTTCTC CGGCTGTAGAGCTGGTAGG 6032 18

19. Genomic Organization of 4 Genes We studied several genes in P19 cells during neural differentiation. Among them, 4 genes showed different responses in early stage of neural differentiation of P19 cells 1 2 3 4 56 7 8 9 101112131415 123456789 1 2 3 4 56 7 8 9 10 112120 121314 1516 1718 19 1. 5-HT3R-A 2. ACTN1 3. CUGBP2 1 2 3 4 56 7 8 9 10 11 121314 4. PTB 5-HT3R-A belongs to the family of ligand- gated ion channels It has 9 exons It has 3’ splice site selection in exon 9 It is expressed in neuron Actinin Alpha 1 is a homodimeric molecules It has 21 exons It has mutually exclusive exons of 18 & 19 It is expressed in neuron CUGBP2 is a member of RNA- binding proteins It has 15 exons It has both 3’ an 5’ splice site selections of exon 11 and 12 It is highly expressed in heart and also in neuron PTB is a polypyrimidine tract binding protein It has 14 exons It has skipping exon 8 19

20. Cell aggregation RA treatment Neural differentiation CUGBP2 PTB ACTN1 5-HT3R-A Why 4 Genes? Any changes? 20

21. Expression Patterns of Isoforms of 5-HT3R-A in P19 Cells during Neural Differentiation Exon 9 (+) isoform is up-regulated within day1 mRNA 89 89 5-HT3R-A gene 8 9 Exon 9 (+) Exon 9 ( - ) 5-HT3R-A 01 4 710 RA Neural Glial Days P19 cells β-actin Exon 9 (+) Exon 9 ( - ) Rel. mRNA, 5-HT3R-A 0 1 47 10 Days 21

22. 5-HT3R-A 0 3 6 12 1824 Hours β-actin Expression of Isoforms of 5-HT3R-A in Early Stage of P19 Cells  The exon 9 (+) isoform is not detected, but it is up-regulated from 3 to 12 hours followed by down regulation upto 24 hours, after the induction of P19 cells and reaches 17% of total 5-HT3R-A (+ & -)  Exon 9 (-) isoform is up-regulated from 3 hours to 24 hours Exon 9 (+) Exon 9 ( - ) Rel. mRNA, 5-HT3R-A 0 3 6 12 1824 Hours Percentages of exon 9 (+) & 9 (-), 5-HT3R-A 0 3 6 12 18 24 Hours 22

23. RA : + - + - Aggr.: ++ - - Exon 9 ( - ) 5-HT3R-A β -actin RA and/or Cell Aggregation on Alternatively Spliced Isoforms of 5-HT3R-A RA : + - + - Aggr.: ++ - - Percentage of exon 9 (+) Percentage of exon 9 (-) 12 Hours Control RA alone increases 15% of exon 9 (+) isoform RA alone up-regulates exon 9 (+) isoform Exon 9 (+) Rel. mRNA, 5-HT3R-A 12 Hours Control 23

24. Summary  Exon 9 (+) of 5-HT3R-A is alternatively spliced within day1 in differentiated P19 cells  The amount of exon 9 (+) was maximum at 12 hours and reaches 17% when compared with at 0 hours  RA alone up-regulates the transcripts of 5-HT3R-A  Exon 9 (-) was the major product of 5-HT3R-A RA Exon 9 (+) Exon 9 (-)  RA increases the exon 9 (+), whereas decreases the exon 9 (-) 24

25. Rel. mRNA, ACTN1 0 1 47 10 Days SM type NM type ACTN1 β-actin 0 14 710 RA Neural Glial Days P19 cells Expression Patterns of ACTN1 Gene in P19 Cells during Neural Differentiation SM isoform of ACTN1 is up-regulated within day 1 ACTN1 gene EF1a SM EF2 NM = Non-muscle, SM = Smooth muscle NM type SM type EF1aEF2 EF1aEF2 mRNA SM NM 25

26. Expression of Isoforms of ACTN1 in Early Stage of P19 Cells Percentages of NM & SM types, ACTN1 0 3 6 12 18 24 Hours Rel. mRNA, ACTN1 0 3 6 12 18 24 Hours  The SM mRNA is not detected, but it’s expression is up-regulated from 3 hours to 12 hours, followed by down-regulation from 12 hours upto 24 hours and reaches 18% of total ACTN1 (NM & SM)  In contrast, just opposite expression was observed in NM isoform SM type NM type ACTN1 0 3 6 12 1824 Hours β-actin 26

27. RA and/or Cell Aggregation on Alternatively Spliced Isoforms of ACTN1 SM type NM type ACTN1 RA : + - + - Aggr.: ++ - - β-actin Rel. mRNA, ACTN1 24 Hours Control Cell aggregation alone affects the NM and SM isoforms of ACTN1 Percentage of SM type RA : + - + - Aggr.: ++ - - 24 Hours Control Percentage of NM type Cell aggregation increases and decreases 25% NM & SM isoforms of ACTN1 27

28.  SM type of ACTN1 is alternatively spliced within day1  The amount of SM was maximum whereas the amount of NM was minimum at 12 hours and SM type reaches 18%  Cell aggregation alone up-regulates SM type, in contrast cell aggregation down-regulates NM type in early stage Summary Cell aggregation SM type NM type  NM type was major product of ACTN1 28

29. Expression Patterns of CUGBP2 Gene in P19 Cells during Neural Differentiation Exon 11 (+) and exon 11 (-) of CUGBP2 are regulated in early stage CUGBP2 β α 014 7 10 RA Neural Glial Days P19 cells β-actin 11 12 CUGBP2 gene β 1112 1112 1112 1112 α Exon 11 (+) mRNA Exon 11 ( - ) Exon 11 (+) Rel. mRNA, CUGBP2 0 1 47 10 Days 29

30. Expression of Isoforms of CUGBP2 in Early Stage of P19 Cells  Exon 11 (+) isoform was up-regulated upto 18 hours, followed by down-regulation from 18 hour to 24 hours  Exon 11 (-) isoform was down-regulated upto 12 hours then up-regulated from 12 to 24 hours  The changes of relative amount of exon 11 (+) and exon 11 (-) isoforms reach 15% of total CUGBP2 CUGBP2 β α 0 3 6 12 1824 Hours β-actin Exon 11 ( - ) Exon 11 (+) Rel. mRNA, CUGBP2 0 3 6 12 1824 Hours 0 3 6 12 1824 Hours Percentages of exon 11(+) & exon 11 (-), CUGBP2 30

31. RA and/or Cell Aggregation on Spliced Isoforms of CUGBP2 Each treatment affects exon 11 (+) and exon 11 (-) of CUGBP2 β -actin CUGBP2 β α Exon 11 ( - ) Exon 11 (+) RA : + - + - Aggr.: ++ - - Percentage of exon 11 (+) Percentage of exon 11 (-) 12 Hours Control RA : + - + - Aggr.: ++ - - Each treatment increases and decreases 25% exon 11 (+) & exon 11 (-) of CUGBP2 Rel. mRNA, CUGBP2 12 Hours Control 31

32.  Exon 11 (+) and exon 11 (-) of CUGBP2 is alternatively spliced within day1  The amount of exon 11 (+) was maximum whereas the exon 11 (-) was minimum at 12 hours and both isoforms change 15%  Each treatment up-regulates exon 11 (+), in contrast each treatment down-regulates exon 11 (-) in early stage Summary Each treatment Exon 11 (+) Exon 11 (-)  The exon 11 (+) was major products of CUGBP2 32

33. RA and/or Cell Aggregation on Alternatively Spliced Isoforms of PTB RA and /or Cell aggregation is independent of PTB isoforms 24 Hours Control Exon 8 ( - ) Exon 8 (+) β-actin PTB RA : + - + - Aggr.: ++ - - Rel. mRNA, PTB 24 Hours Control RA : + - + - Aggr.: ++ - - mRNA 789 79 7 PTB gene Exon 8 (+) Exon 8 ( - ) 8 9 33

34. Possible Mechanism of RA and/ or Cell Aggregation on Alternative Splicing RA treatment alone or cell aggregation alone or each treatment changes alternatively spliced isoforms Cell aggregation RA treatment Neural differentiation CUGBP2 PTB ACTN1 5-HT3R-A SM type NM type Exon 11 (+) Exon 11 (-) Exon 9 (+) Exon 9 (-) is independent of RA and/or cell aggregation 34

35. Chapter-III Biological Function of Alternative Splicing in Neural Differentiation of P19 Cells 35

36. Fgf8 on Neural Induction in P19 Cells Wang et al., Molecular Biology of Cell; 2006 P19 EC cell Neural stem cell 36

37. Fgf8 and Splicing Variants Fgf8 -member of FGF family -highly expressed in isthmus of mid-hindbrain junction and fore brain - structurally most complicated gene than other FGFs Fgf8 gene structure has:- : skipping exon (1C) : 3′splice site selection (1D) : 5′splice site selection (1B) McArthur et al., Development; 1995 Rosanno D, Am. J. Physiol.; 2003 Fgf8 in telenchephalon (arrowhead) and isthimic organizer (arrow) 37

38. Reason And Objective of This Study  FGF signaling is involved in neural differentiation of P19 cells  Fgf8 knockout mice die before embryonic day 9.5 (E9.5), which suggests its biological importance in early neural development  Fgf8 has 8 isoforms (a-h), but which isoforms are involved in neural differentiation remained unknown Reason Objective  To investigate which isoforms have biological function in early stage of neural differentiation 38

39. Fgf8b is the most predominant isoform Splicing Patterns & Expression of Fgf8 in P19 Cell during Neural Differentiation 0 1 24 5 Days 3 67 Ratio of Fgf8b/Fgf8a Neural differentiation RA induction P19 cells Relative mRNA expression 0 1 24 5 Days 3 67 Neural differentiation RA induction P19 ells Fgf8b Fgf8a 0 1 2 4 5 Days 3 67 β-actin RA induction Neural differentiation P19 cells Fgf8a Fgf8b Exon1b Exon1c Exon1d Fgf8 gene mRNA I identified Fgf8a & b but not Fgf8c, d, e, f, g & h 39

40. Aggr.: RA : - - + + + + + + + + + + Relative mRNA expression 0 3 6 12 1824 Hours Expression Analysis of Fgf8 in Early Stage of P19 Cells Fgf8b elevation was maximum from 12 hours to 18 hours after RA treatment 40

41. Expression Analysis of Fgf8 Based on RA and/or Cell Aggregation Fgf8b elevation is cellular aggregation dependent Aggr.: RA : + + - + + - - - Relative mRNA expression 24 Hours Control 41

42. Possible Mechanism of Fgf8b on Neural Induction in P19 Cells Fgf8b but not all Fgf8 variants is impressive for P19 cell neural differentiation. Smad1-Smad4 Nucleus Aggregation.… Smad4 Changes splicing mechanism ? Neural induction P19 EC cell Neural Stem cell.…..………... BMP Extracellular Cytoplasm Smad1 P Fgf8b Erk1/2 P RA...… 42

43. Conclusion  Fgf8a and Fgf8b were expressed rapidly but transiently within day 1 in neural differentiation of P19 cell  Fgf8b was predominant among Fgf8 isoforms  Elevated Fgf8b expression was cell aggregation dependent  Fgf8b but not other variants is important in early stage of neural differentiation of P19 cell  Splicing factors may regulate the mechanism of elevation of alternatively spliced Fgf8b isoform in neural differentiation 43

44. Chapter-IV Study Mechanism of Alternative Splicing 44

45. P19 cells 01 4 7 10 RA Glial Neural β-actin NSSR-1 Days Nova-1 Nova-2 Fox-1 NSSR-2 Expression Analysis of Splicing Factors in Neural Differentiation of P19 Cells 45

46. 24 Hours 0 Aggr.: RA : + + - + + - - - NSSR-1 β-actin Nova-2 Nova-1 Fox-1 NSSR-2 RA and/or Cell Aggregation on Splicing Factors 46

47. Schematic Representation of CUGBP2 and Its Isoform CUGBP2 R3δ CUGBP2 is a member of CELF family protein It has 15 exons which encoded 524 amino acids It has 2 RRM in N-terminal, a linker region and 1RRM in C-terminal Exon 14 encoded amino acids are located in first two third of RRM3 It is highly expressed in brain and heart tissues It acts as a splicing regulator CUGBP2 R3δ is an alternatively spliced product of CUGBP2 It lacks exon 14 which makes it 480 amino acids in length Like CUGBP2, it has 2 RRM in N-terminal, a linker region but a partial RRM in C-terminal UCSC blat search suggest that 25% of CUGBP2 transcripts is responsible for CUGBP2 R3δ 1524 RRM2RRM1LinkerRRM3 439483 1480 RRM2RRM1Linker CUGBP2 CUGBP2 R3δ CUGBP2 gene CUGBP2 CUGBP2 R3δ 131415 1315 mRNA 131415 1112 47

48. So Far Published Results CUGBP2 cTNT exon 5 inclusion ACTN1 SM exon inclusion NMDA R1 exon 21 inclusion NMDA R1 exon 5 inclusion IR exon 11 inclusion APP exon 8 inclusion CUGBP2 R3δ Any function? 48

49. Reason And Objective of This Study  CUGBP2 has been known as positive and negative splicing regulator  To investigate whether the alternatively spliced isoform of CUGBP2 has different function in splicing regulation Reason  Still there has been no report about the different effect of CUGBP2 R3δ in splicing regulation Objective 49

50. Expression Analysis of Alternatively Spliced Isoform of CUGBP2 in Tissues and Cells CUGBP2 is expressed as major product in brain BrainHeartKidneyLiverMuscularSpleen CUGBP2 CUGBP2 R3δ β-actin CUGBP2 CUGBP2 R3δ 131415 1315 mRNA CUGBP2 gene 131415 ( Days ) CUGBP2 R3δ CUGBP2 β-actin 01 4 710 RA Glial Neural P19 cell This result is consistent with alternative splicing patterns in brain 50

51. Suzuki et al., Genes to Cell; 2002 CUGBP2 ACTN1 SM exon inclusion CUGBP2 R3δ Any function? CUGBP2 induced SM exon inclusion of ACTN1 51

52. Expression Analysis of Alternatively Spliced Isoform of ACTN1 in Tissues and Cells SM type is major in brain, neural and glial stage where CUGBP2 was highly expressed In kidney, liver and undifferentiated P 19 cells, NM type was major where the expression of CUGBP2 and CUGBP2 R3δ was low NM type SM type EF1aEF2SM mRNA NM = Non-muscle, SM = Smooth muscle ACTN1 gene EF1a NM SM EF2 BrainHeartKidneyLiverMuscularSpleen β-actin NM type SM type NM type β-actin ( Days ) 01 4 710 RA Glial Neural P19 cells EF1aEF2NM 52

53. Transient Transfection Experimental Methods Construction of minigene Co-transfection of reporter and effectors in Cos-7/HeLa cells Collect Total RNAs RT-PCR PAGE Densitometry 53

54. SM type NM type - + Etr-1 - - Effector : ACTN1 minigene : +++ CUGBP2 R3δ CUGBP2 MOCK CUGBP2 R3δ Etr-1 % of SM exon EF2a ACTN1 minigene EF1a NM SM EF2a Effect of CUGBP2 and CUGBP2 R3δ on ACNT1 minigene Etr-1 is a RNA binding protein Like CUGBP2, it has 2 RRM in N-terminal, a linker region and 1 RRM in C-terminal It acts as a splicing regulator 54

55. CUGBP2 and CUGBP2 R3δ induced SM exon inclusion of ACTN1 Summary of ACTN1 by CUGBP2 and CUGBP2 R3δ CUGBP2 ACTN1 SM exon inclusion CUGBP2 R3δ ACTN1 SM exon inclusion 55

56. CUGBP2 CUGBP2 R3δ Any different function? CUGBP2 Repressed Insulin Receptor (IR) Exon 11 Inclusion IR exon 11 inclusion 56

57. Expression analysis of IR (Insulin Receptor) in Tissues mRNA IR-B (exon 11 +) 1012 101112 IR-A (exon 11 - ) IR gene 10 1112 IR is a heterotetramer with two extracellular α-subunit and two identical trans membrane β-subunit IR has 22 exons including skipping exon 11 It is highly expressed in fetal tissues and cancer cells BrainHeartKidneyLiverMuscularSpleen IR-B (exon 11 +) IR-A (exon 11 - ) β-actin  Exon 11 (-) is major in brain where CUGBP2 was highly expressed.  Exon 11 (+) is major in kidney and liver, where CUGBP2 and CUGBP2 R3δ were major products 57

58. % of exon inclusion MOCK CUGBP2 R3δ Etr-1 IR-B (exon 11 +) IR-A (exon 11 -) - + Etr-1 - - Effector : IR-b minigene : +++ CUGBP2 R3δ CUGBP2 1011 12 IR-b minigene Effect of CUGBP2 and CUGBP2 R3δ on IR minigene 58

59. While CUGBP2 repressed IR exon inclusion interestingly CUGBP2 R3δ induced IR exon inclusion CUGBP2 CUGBP2 R3δ IR exon 11 inclusion Summary of IR by CUGBP2 and CUGBP2 R3δ 59

60. Possible Mechanism of Regulation of Splicing CUGBP2 R3δ has different function in splicing regulation of IR gene Brain and Neural cells CUGBP2 ACTN1 SM exon Liver and Kidney CUGBP2 IR exon 11 CUGBP2 R3δ 60

61. Chapter-V Summary Summary 61

62.  RA treatment and cell aggregation independently regulate alternative splicing in early stage of P19 cells Chapter-II  The alternatively spliced isoforms of 5-HT3R-A, ACTN1, and CUGBP2 showed early response in neural differentiation of P19 cells  These spliced variants might play role in neurogenesis  SR proteins might be involved in alternative splicing regulation in early stage of P19 cells 62

63. Chapter-III  The changes of alternatively spliced isoforms of Fgf8b was higher than that of Fgf8a  Fgf8b but not all Fgf8 variants might play role for neural differentiation of P19 cells  Fgf8b was abundant among all Fgf8 isoforms  Fgf8b was expressed rapidly but transiently in early stage of P19 cells during neural differentiation  Splicing factors might regulate elevated Fgf8b splicing mechanism during differentiation 63

64.  CUGBP2 and CUGBP2 R3δ induced SM exon inclusion of ACTN1 Chapter-IV  CUGBP2 R3δ showed opposite function of CUGBP2 in regulation of IR splicing  CUGBP2 repressed IR exon 11 inclusion, whereas CUGBP2 R3δ promoted IR exon 11 inclusion 64

65. THANK YOU! 65