Presentation is loading. Please wait.

Presentation is loading. Please wait.

Gene Expression DNA  RNA  Protein Transcription  Translation What is the language of DNA?

Similar presentations


Presentation on theme: "Gene Expression DNA  RNA  Protein Transcription  Translation What is the language of DNA?"— Presentation transcript:

1 Gene Expression DNA  RNA  Protein Transcription  Translation What is the language of DNA?

2 DNA Double Helix- Deoxyribonucleic acid “Genetic material of Life” “Twisted” ladder

3 Nucleotides- Building Blocks

4 Nucleotide- Base, sugar, phosphate group

5 Nitrogen Bases Purine, Adenine, Guanine, Pyrimidine. Thymine, Cytosine “Y”- pyrimidine

6 Complimentary Base pairs Adenine - -Thymine (A T & T) - two Cytosine Guanine Combine by double / triple bonds. (-) = Hydrogen bonds

7 DNA Double Helix

8 DNA Replication DNA replication (chromosomes replicated during S phase) is SEMI-CONSERVATIVE. 4PGlCc

9 What is semi-conservative? Match Original two strands of DNA (at left)- Which figure below represents semi- conservative copying? A C B D

10 Replicated DNA contains ½ one Old and ½ one New – why? Fig Iguana, 9-9 Manatee Reduce mistakes and is faster. Replication  DNA Replication Simple Best DNA-

11 DNA Replication DNA is “unzipped” by DNA Helicase (Helix is shape of DNA = spiral)

12 DNA Replication New bases added by DNA Polymerase. 5’ to 3’, direction. (like one end to other).

13 DNA Replication Give complimentary side of this sequence DNA below TAC/ACC/TAG/CTT/TTGACGGGGAACCCCATT ATG/TGG/ATC/GAAAACTGCCCCTTGGGGTAA DNA is proofread and errors are only 1 in every Billion nucleotides!

14 Objectives Compare The structure of RNA with that of DNA. Summarize Transcription- DNA  RNA

15 Gene Expression/ Central Dogma for Molecular Biology DNA  (Transcription) RNA  (Translation) Proteins

16 Decoding the Information in DNA Traits- eye color, hair color determined by proteins, built according to instructions coded in DNA. Proteins however, not built directly from DNA but from Ribonucleic acid. Ribonucleic acid (RNA) nucleic acid similar to DNA.

17 DNA  RNA- Transcription DNA is like a book, Chapters are Chromosomes, Sections are Genes DNA stays protected in nucleus ** (Do not want to damage)** RNA is copied from shorter sequence of DNA, leaves nucleus RNA is Working copy of DNA- leaves nucleus.

18 Transcription- (Nucleus)

19 Removal of introns After Transcription- mRNA leaving is called exons = GENE

20 3 Types of RNA

21 Ribonucleic Acid

22 Comparing DNA/RNA- 3 differences DNA Two strands Deoxyribose Sugar Thymine A- - T C ---G RNA Single strand Ribose Sugar Uracil NO Thymine A-U C-G

23 Transcription- (Nucleus) RECALL- DNA/DNA TAC/ACC/TAG/CTT/TTGACGGGGAACCCCATT ATG/TGG/ATC/GAA/AACTGCCCCTTGGGGTAA Given DNA sequence below What is the complimentary mRNA? Recall NO Thymine! TAC/ACC/TAG/CTT/TTG/ACG/GGG/AAC/CCC/ATT AUG/UGG/AUC/GAA/AAC/UGCCCCUUGGGGUAA

24 Objectives Outline The major steps of translation. Relate Codons to the sequence of amino acids that results after translation. Discuss The evolutionary significance of the genetic code.

25 Translation: Assembling Proteins Section 1 From Genes to Proteins Chapter 10

26 Translation-(Cytoplasm) RNA  Proteins RNA Code is read CODON – “Code on” mRNA- messenger RNA CODON = 3 Bases ON- results in Amino Acid Chain of Amino Acids makes protein (polypeptide)

27 Translation RNA  Protein UGUUAUAUCGAAAACUGCCCCUUGGGGUAA Read every 3 bases= CODON UGU/UAU/AUC/GAA/AAC/UGC/CCC/UUG/GGG/UAA

28 Codon- sheet Why read every 3 bases? Codon combinations must cover 20 different AA- Amino Acids 4 1 = = = 64 CHECK! Results in 64 combinations Start sequence AUG. End sequence UAA, UAG, UGA.

29 Codes in mRNA

30 Translation RNA  Protein UGUUAUAUCGAAAACUGCCCCUUGGGGUAA Read every 3 bases= CODON UGU/UAU/AUC/GAA/AAC/UGC/CCC/UUG/GGG/UAA

31 Amino Acids Amino acids can be Polar/Non Polar Hydrophobic/Hydrophilic Acidic/Basic Depending on sequence this will make a shape = GENE

32 Translation: Forming the First Peptide Bond Section 1 From Genes to Proteins Chapter 10

33 tRNA tRNA- Transfer RNA, “transfers” the Amino Acid to the ribosome to make protein tRNA is complimentary to mRNA, “lock & key” fit. Every codon has only one Anticodon. AUG/CAA- Codon UAC/GUU- Anticodon- specific AA Met-Glu- Amino acids

34 Translation: Assembling Proteins Section 1 From Genes to Proteins Chapter 10

35 Video showing transcription/translation https://www.youtube.com/watch?v=erOP76_ qLWA https://www.youtube.com/watch?v=erOP76_ qLWA

36

37 Mutations

38 Major Types of Mutations

39 Mutation- Change in sequence of the DNA- deoxyribonucleic acid A. Chromosomal- whole, parts added or deleted, sections translocated to other chromosomes. B. Gene- – 1. Point – 2. Frameshift. Somatic-affects individual- EX. skin cancer. Genetic- affects sperm or egg affects offspring.

40 Gene mutations 1. Point mutation- affects one nucleotide fig p. 230 Iguana p. 219 Manatee Ex. TAC GTT CCA, change TAC GTA CCA, If this makes different codon (language of genetics), = new amino acid

41 Point mutation analogy The dog ran out the box Point mutation Change D and C. The Cog ran out the box.

42 Frame shift mutation B. Frame shift mutation- removal of a base(s) or insertion of a segment, results in different “reading” of gene. CODON= 3 bases. TAC GTT CCA- original sequence. T(AC G)TT CCA  remove first (T) ACG TTC CA…. TA)C GTT CCA  insert T TTA CGT TCC A

43 Frame shift mutation analogy The dog ran out the box TTh edo gra nou tth ebo x. ADDITION of a T Heg ogr ano uth heb ox DELETION of a T

44 Genetic Code- Evolutionary significance The code AUG/CCC/, whether in human or oak tree, or mosquito, etc.. makes same amino acids….Met--Pro This shows relatedness of all living organisms.

45 How can a glow in the dark gene from Jellyfish work in a pig? DNA is a code like words if it fits and makes sense, then it can be used. The dog ran down the street. The cat ate a bird. The dog ate a bird. Still makes “sense”.


Download ppt "Gene Expression DNA  RNA  Protein Transcription  Translation What is the language of DNA?"

Similar presentations


Ads by Google