Presentation is loading. Please wait.

Presentation is loading. Please wait.

Figures for John M. Butler’s Advanced Topics in Forensic DNA Typing: Methodology (2012)

Similar presentations


Presentation on theme: "Figures for John M. Butler’s Advanced Topics in Forensic DNA Typing: Methodology (2012)"— Presentation transcript:

1 Figures for John M. Butler’s Advanced Topics in Forensic DNA Typing: Methodology (2012)

2 Chapter 1 – Sample Collection & Characterization

3 DNA Profile Comparison QK Court Database Search Exclusion (no match) Inclusion (match) May match another (K’) Collection Extraction Quantitation STR Markers Data Interpretation Sample Storage Amplification Statistical Interpretation Characterization Separation/ Detection Evidence (Question) sample “Q” Biology Technology Genetics Serology Profile put on database Steps Involved Plea Report (with statistical weight) Q = K Q ≠ K Crime committed Biological material transferred Collection Extraction Quantitation STR Markers Data Interpretation Sample Storage Amplification Separation/ Detection Reference (Known) sample “K” Profile put on database Steps Involved Suspect developed QUALITYASSURANCEQUALITYASSURANCE QUALITYASSURANCEQUALITYASSURANCE

4

5 Evidentiary Sample (stain from crime scene) Co-extract RNA and DNA RNA DNA Body fluid ID STR profiling Reverse transcriptase (RT)-PCR PCR

6 Real-time PCR (for presence or absence of target gene) RNA Reverse transcriptase PCR cDNA Capillary electrophoresis separation/detection (for presence or absence of target gene)

7 Chapter 2 – DNA Extraction

8 ORGANIC FTA Paper CHELEX Blood stain PUNCH WASH Multiple Times with extraction buffer PERFORM PCR PCR Reagents SDS, DTT, EDTA and proteinase K INCUBATE (56 o C) Phenol, chloroform, isoamyl alcohol QUANTITATE DNA Apply blood to paper and allow stain to dry Blood stain VORTEX (NO DNA QUANTITATION TYPICALLY PERFORMED WITH UNIFORM SAMPLES) Water INCUBATE (ambient) 5% Chelex INCUBATE (100 o C) REMOVE supernatant INCUBATE (56 o C) QUANTITATE DNA PERFORM PCR Centrifuge REMOVE supernatant TRANSFER aqueous (upper) phase to new tube CONCENTRATE sample (Centricon/Microcon-100 or ethanol precipitation) Centrifuge TE buffer

9 Lyse cells Release DNA Bind to Magnetic Beads (collect beads with magnet) Wash Beads Elute Clean DNA

10

11 Perpetrator’s sperm mixed with victim’s epithelial cells Centrifuge REMOVE supernatant SDS, EDTA and proteinase K (cell lysis buffer) Remove a portion of the mixed stain SDS, EDTA and proteinase K + DTT Incubate at 37 o C sperm pellet DTT lyses sperm heads ‘Sperm Fraction’ ‘Non-sperm Fraction’ sperm pellet Differential Extraction

12 Evidence (Q) Reference Samples (K) Differential extraction Victim Suspect non-sperm fraction sperm fraction (a) (b) (c) (d)

13 Sexual Assault A mixture of cells is created Sperm (perpetrator(s)) Vaginal, rectal, or buccal epithelial cells (victim) + Selective PCR with Y-STRs Differential cell lysis Selective cell degradation with DNase digestion Selective cell capture with laser microdissection Labor-intensive and some sample is lost during washes; carryover may occur between fractions Creation of two fractions: a)Non-sperm fraction b)Sperm fraction Can isolate male- portion even with high female cell background but not as informative due to paternal lineage sharing Destroys portion of evidence (female cells) Time-consuming; expensive equipment “GOLD STANDARD”

14 Chapter 3 – DNA Quantitation

15 Too much DNA amplified (a)(b) Too little DNA amplified (c) Within optimal range

16 Extract DNA Quantitation Too much DNAToo little DNA Dilute sample (to normalize) PCR Amplification Concentrate sample (to normalize) Optimal range Low template DNA approaches (e.g., more PCR cycles)

17 20 ng 10 ng 5 ng 2.5 ng 1.25 ng 0.63 ng20 ng 10 ng 5 ng 2.5 ng 1.25 ng 0.63 ng Calibration standards Unknown Samples ≈2.5 ng

18 Polymerization and Strand Displacement R Q Forward primer Reverse primer 3’ 5’ 3’ 5’ 3’ 5’ Forward primer Reverse primer 3’ 5’ 3’ 5’ Q R 3’ Probe Cleavage (release of reporter dye) Forward primer Reverse primer 3’ 5’ 3’ 5’ Q R Completion of Polymerization TaqMan probe Fluorescence occurs when reporter dye and quencher dye are no longer in close proximity

19 Cycle Number Normalized Fluorescence threshold CTCT Exponential product growth Linear product growth Plateau ΔRnΔRn Negative control ab cd e Standard curve CTCT Log[DNA] a b c d e N c = N o (1 + E) c If efficiency is close to 100% (E = 1), then the product copy number (N c ) doubles the target copy number (N o ) with each cycle (c).

20 1 ng sample (a) (b)

21 Concordance Apparent Precision

22 3,068 casework samples DNA quantitation STR amplification EZ1 DNA extraction (no inhibitors seen) Quantifiler (performed twice and results averaged) Nanoplex QS and SEfiler (with up to 500 pg DNA added) Group pg/µL 1564 samples Group pg/µL 279 samples Group pg/µL 371 samples Group 4 >30 pg/µL 854 samples No results Full profile Partial profile 96% 3% 1% 67% 23% 10% 26% 67% 7% 3% 96% 1% Kremser et al. 2009

23 0,00,>0>0,>0 Number of Samples Positive results0%7%27% Negative results100%93%63% 1564 Samples with ‘Zero’ Quantifiler Results (pg/µL) Kremser et al When both Quantifiler results were zero, then all subsequent STR testing failed to obtain a result

24 Chapter 4 – PCR Amplification

25 94 o C 60 o C 72 o C Time Temperature Single Cycle Typically cycles performed during PCR 94 o C 60 o C 72 o C The denaturation time in the first cycle is lengthened to ≈10 minutes when using AmpliTaq Gold to perform a ‘hot-start’ PCR

26 Separate strands (denature) Add primers (anneal) Make copies (extend primers) Repeat Cycle, Copying DNA Exponentially Starting DNA Template 5’ 3’ 5’ 3’ 5’ Forward primer Reverse primer

27 (a) Simultaneous amplification of three locations on a DNA template (b) Resolution of PCR products with size-based separation method Locus A Locus B Locus C Dye- labeled PCR primers Dye-labeled PCR products A C B smallest  largest

28 A T G G C A T T A C G A T G G C A T T A G G Fluorescent dye High stability base analogs Extra (degenerate) primer to match primer binding site mutation D R Energy-transfer dye cassette for brighter dyes 5’3’ 5’3’ Non-nucleotide linkers (mobility modifiers)

29 True amount What might be sampled by the PCR reaction… High copy number >20 copies per allele Low copy number 6 copies per allele Resulting electropherogram OR Copies of allele 1 Copies of allele 2 Allele imbalanceAllele dropout Extreme allele imbalance Complete (and correct) genotype What is sampled is consistent with the true amount present in the sample

30 Chapter 5 – STR loci and kits

31

32

33 D16 Allelic Ladders PowerPlex ESI 17 IdentifilerPowerPlex 16 IDplex

34 ESSplex (Qiagen) PowerPlex ESX 17 (Promega) Identifiler (Applied Biosystems) PowerPlex 16 (Promega) NGM SElect (Applied Biosystems)

35 Loci Amelogenin CSF1PO FGA TH01 TPOX vWA D3S1358 D5S818D7S820 D8S1179D13S317D16S539 D18S51D21S11 D2S1338D19S433 Penta D Penta E D1S1656 D2S441 D10S1248 D12S391 D22S1045 SE33 Autosomal STR Typing Kits Applied Biosystems AmpFlSTR kits Profiler Profiler Plus (ID) COfiler SGM Plus Identifiler (Direct, Plus) SEfiler Plus MiniFiler NGM NGM SElect Promega PowerPlex kits PowerPlex 1.1 (1.2) PowerPlex PowerPlex 16 (BIO, HS) PowerPlex S PowerPlex ES PowerPlex ESX PowerPlex ESX PowerPlex ESI PowerPlex ESI PowerPlex 18D Qiagen Investigator kits ESSplex ESSplex SE Hexaplex ESS Nonaplex ESS Decaplex SE IDplex

36 ’-TTTCCC TCAT TCAT TCAT TCAT TCAT TCAT TCACCATGGA-3’ 3’-AAAGGG AGTA AGTA AGTA AGTA AGTA AGTA AGTGGTACCT-5’

37

38 X Y 6 bp deletion Normal Female: X,X X Normal Male: X,Y XY X Y Male (AMEL X null) Male (AMEL Y null)

39 Chapter 6 – CE Instrumentation

40 Laser Inlet Buffer Capillary filled with polymer solution 5-20 kV -+ Outlet Buffer Sample tray Detection window (cathode) (anode) Data Acquisition Sample tray moves automatically beneath the cathode end of the capillary to deliver each sample in succession

41 Mixture of dye-labeled PCR products from multiplex PCR reaction CCD Panel (with virtual filters) Argon ion LASER (488 nm) Color Separation Fluorescence ABI Prism spectrograph Size Separation Processing with GeneMapperID software Sample Interpretation Sample Injection Sample Separation Sample Detection Steps in STR Typing with ABI 310/3100 Sample Preparation Capillary (filled with polymer solution)

42 Sample Tube DNA - - Electrode Capillary DNA - - PCR products in formamide or water (a)(b) Multi-Capillary Electrode Configuration

43 + Electrophoretic flow SiOH SiO- + H + Capillary Wall Electroosmotic flow (EOF) DNA EOF Bulk Flow + -

44 (a) (b) (c)

45 Dichroic Mirror Capillary Holder Microscope Objective Lens Laser Shutters Laser Filter Diverging Lens Capillary Long Pass Filter Re-imaging Lens Focusing Mirror CCD Detector Diffraction Grating Argon-Ion Laser (488/514 nm)

46 LASER Excitation (488 nm) Capillary Array ABI 3100, 3130, 3100Avant LASER Excitation (488 nm) Side irradiation (on-capillary) Sheath flow detection ABI 3700 LASER Excitation (488 nm) Fixed laser, moving capillaries MegaBACE

47 nm Filter A Filter C Filter F Filter G5 FL FAM TET VIC JOE HEX NED TMR PETROXLIZ Visible spectrum range seen in CCD camera (a) (b)

48 WAVELENGTH (nm) Filter Set F with color contributions 5-FAMJOENED ROX Laser excitation (488, nm) Laser excitation (488, nm) Normalized Fluorescent Intensity

49 Scan number Relative Fluorescence Units DNA size in base pairs Relative Fluorescence Units Region shown below Primer peak (a) (b)

50 ABI 3100 Data Collection v1.0.1 ABI 3130xl Data Collection v3.0 (a)(b)

51 Capillary Heat plate Detection window electrode Autosampler Gel block Syringe (with polymer) Outlet buffer reservoir Inlet buffer reservoir Sample tray Samples

52 Mechanical pump (with polymer) Capillary array Oven Detection window electrodes Autosampler Lower gel block Polymer bottle Outlet buffer reservoir Inlet buffer reservoir Sample tray Fan

53 (a) ABI 3100 (b) ABI 3130xl Mechanical pump (for polymer delivery) Polymer bottle Outlet buffer reservoir Dual syringes (for polymer delivery) Outlet buffer reservoir

54 Mechanical pump (with polymer) Capillary array (behind oven door) Oven door Autosampler Polymer pack Outlet buffer reservoir (with RFID) Inlet buffer reservoir

55 h ex h em SoSo S’ 1 S1S1 energy Excitation Emission Wavelength (nm) 1 3 ex max em max Fluorescence Stokes shift

56 Chapter 7 – Validation and QA

57 infinity1.96

58 STR repeat region PCR primer set 2 PCR primer set 1 * allele a STR repeat region PCR primer set 2 PCR primer set 1 allele b Set 1 AmpliconsSet 2 Amplicons If no primer binding site mutations = a ba b Set 1 Amplicons Set 2 Amplicons ≠ ab b If a primer binding site mutation ( )exists *

59 Chapter 8 – DNA Databases

60 National Level NDIS (FBI Laboratory) SDIS (Richmond, Virginia) SDIS (Tallahassee, Florida) LDIS (Tampa) LDIS (Orlando) LDIS (Broward County) LDIS (Roanoke) LDIS (Norfolk) LDIS (Fairfax) State Level Local Level

61 Primary Searches Conducted Offender Index Offenders Profiles (N) Crime Profiles (C) Forensic Index 1a ‘Offender Hit’ ‘Forensic Hit’ New offender profiles New crime profiles 1b 2 ‘Offender Hit’

62 one-to-one one-to-many many-to-many (between indices) (a) (b) (c) Number of Comparisons 1 N C x N all-to-all (within indices) (d) N x (N-1) N Crime scene profile Suspect profile N Crime scene profile Offender index N C Forensic index Offender index

63 Core set of markers (e.g., CODIS 13 STRs) Past and Present Future (a) (b) (c) (d) Possible scenarios for extending sets of genetic markers to be used in national DNA databases

64 Chapter 9 – Missing persons & mass disasters

65 MP Index Personal Effects from Missing Persons (MP) Unidentified Human Remains (UHR) UHR Index Relatives Index Biological Relatives of Missing Persons 1 23 Re-association of remains 4 Confirmation of relatives and MP relationship Searching for Direct Match Searching for Kinship Association

66 DNA profile from mass disaster victim DNA profile from direct reference (toothbrush believed to have belonged to the victim) (a) Direct comparison (b) Kinship analysis D5S818D13S317 D7S820 D16S539 CSF1PO Penta D ? son wife victim D5S818D13S317D7S820 D16S539CSF1POPenta D 10,109,109,138,98,1411,13 son wife 10,128,108,98,12 11,13 10,109,1211,139,911,1412,13 ?,109,??,13 9,? ?,14 11,? or ?,13 victim (father) actual profile Predicted victim profile mass disaster victim profile Figure 24.1, J.M. Butler (2005) Forensic DNA Typing, 2 nd Edition © 2005 Elsevier Academic Press

67 Missing Individual Spouse SonDaughter BrotherSister FatherMother NieceNephew Grandmother Uncle Aunt Cousin Figure 24.2, J.M. Butler (2005) Forensic DNA Typing, 2 nd Edition © 2005 Elsevier Academic Press

68 1277 crash scene samples 229 VICTIMS 310 Relative Reference Samples 89 Personal Effects Collections using FTA paper (from 22 countries) RELATIONAL DATABASE 9 STR loci typed (Profiler Plus) Sorted groups 9 STR loci tested (Profiler Plus) 4 additional STR loci tested (COfiler) 4 additional STR loci tested (COfiler) Identification of 229 victims Database query Figure 24.3, J.M. Butler (2005) Forensic DNA Typing, 2 nd Edition © 2005 Elsevier Academic Press

69 NYSP (Albany) OCME BodeMyriad Orchid Cellmark Celera Extract Swab Personal Effect Bone Tissue (a) Material Flow

70 NYSP (Albany) OCME BodeMyriad Orchid Cellmark Celera WTC CODIS M-FISys QC Check QC Check (b) Data Flow

71 Chapter 10 – DNA Degradation

72 Size of Intact DNA Molecules Needed (bp) Various DNA Tests RFLP D1S80 STRs miniSTRs mtDNA

73 Degraded DNA sample D5S818 D13S317 D7S820 D16S539 CSF1PO Penta D Agarose yield gel results Smear of degraded DNA fragments High relative molecular mass DNA in a tight band (a) (b) Good quality DNA Degraded DNA

74 Full Profile (Good Quality) Partial Profile (Poor Quality) (a) (b) DNA size (bp) relative to an internal size standard (not shown) Relative fluorescence units (RFUs)

75 STR repeat region miniSTR primer Conventional PCR primer (a) (b) Conventional STR test (COfiler kit) MiniSTR assay (using Butler et al primers) 150 bp smaller

76 Chapter 11 – Low-level DNA

77 DNA amount (log scale) 28 cycles31 cycles34 cycles 10 ng 1 ng 0.1 ng 0.01 ng (100 pg) (10 pg) Detection Sensitivity Allele drop-in Allele imbalance Allele drop-out Locus drop-out Off-scale data (leads to artifacts) Optimal data

78 Allelic Drop-out 14 allele drop-out Identifiler, 30 pg DNA, 31 cycles High Stutter 64% stutter Identifiler, 10 pg DNA, 31 cycles Allelic Drop-in 16 allele drop-in Identifiler, 10 pg DNA, 31 cycles Severe Peak Imbalance Identifiler, 30 pg DNA, 31 cycles 10,1112,1412,1318,19 Correct genotype: 30% peak height ratio

79 Replicate #1 High stutter Consensus Profile: 14,197,9.312,1311,1324,Z Correct Profile: 14,197,9.312,1311,1318,24 Replicate #2 Replicate #3

80 Single Amplification Amplification #1 (only a single test) Result can be Unreliable Low amount of DNA examined Stochastic effects Replicate Amplification with Consensus Profile Amplification #1 Amplification #2 Amplification #3 Consensus Profile Developed (from repeated alleles observed) Interpretation Rules Applied (based on validation experience) e.g., specific loci may dropout more Result can be and usually is Reliable & Reproducible Low amount of DNA examined Stochastic effects

81 31 Cycles 10 pg 30 pg 100 pg 28 Cycles 10 pg 30 pg 100 pg

82 Chapter 12 – SNPs and AIMs

83 Protocol Steps for Allele-Specific Primer Extension SNP Assay Genomic DNA sample (Multiplex) PCR ExoSAP Digestion Add SNP primer(s) and SNaPshot mix SNP Extension (cycle sequencing) SAP treatment Data Analysis (GeneScan) Type Sample (Genotyper or GeneMapperID) Amplification Primer Extension Analysis Sample prep for 310/3100 Add GS120 LIZ size standard Run on ABI 310/3100 Use E5 filter (5-dye) and POP4 standard conditions

84 TT CTCT CC CTCT CTCT TT (a) (TTTTT)–(TTTTT)-primer2(chromosome 6)-ddC/ddT (TTTTT)–primer1(chromosome 20)-ddT/ddT (TTTTT)–(TTTTT)–(TTTTT)-primer3(chromosome 14)-ddC/ddT (TTTTT)–(TTTTT)–(TTTTT)–(TTTTT)-primer4(chromosome 1)-ddC/ddC (b) Sample 1 Sample 2

85 Chapter 13 – Y-chromosome

86 Autosomal (passed on in part, from all ancestors) Y-Chromosome (passed on complete, but only by sons) Mitochondrial (passed on complete, but only by daughters) Lineage Markers

87 Female-Male Mixture Performance with Autosomal vs. Y-Chromosome DNA Markers Female Victim DNA Profile Male Perpetrator DNA Profile DNA Profile from Crime Scene Autosomal STR Profile Y-Chromosome STR Profile No signal observed

88 ? uncle 3 rd cousin

89 (a) (b) Pseudoautosomal Region 1 (PAR1) Pseudoautosomal Region 2 (PAR2) Non-Recombining Portion of Y Chromosome (NRY) Male-specific region of the Y (MSY) 50 Mb X Y 154 Mb Yp Yq Heterochromatic region (not sequenced) ~30 Mb Euchromatic region (23 Mb) centromere recombination

90 DYS385 a/b a = b a  b DYS389 I/II (a) (b) I II F primer R primer a b Duplicated regions are 40,775 bp apart and facing away from each other F primer R primer F primer R primer DYS389I DYS389II Multi-Copy (Duplicated) Marker Single Region but Two PCR Products (because forward primers bind twice)

91 DYS19 Mb p q DYS393 DYS392 Y DYS456 DYS458 AMEL Y DYS391 DYS635 centromere heterochromatin PAR1 PAR2 DYS448 DYS385a DYS385b GATA-H4 DYS390 DYS437 DYS439 DYS389I/II DYS438

92 100 bp 400 bp300 bp200 bp DYS391 PowerPlex Y DYS389I DYS439 DYS389II DYS438 DYS437 DYS19DYS392 DYS393DYS390DYS385a/b AmpF l STR Yfiler DYS437DYS448H4 100 bp 400 bp300 bp200 bp DYS456 DYS389IDYS390DYS389II DYS458 DYS19DYS385a/b DYS393DYS439DYS392 DYS438 DYS391 DYS635 FL JOE TMR 6-FAM VIC NED PET (a) (b)

93

94 9-14 [GATA] [GATA] 1 N4N4 N 14 N3N3 N7N7 [GATA] [ATCT] [AGAT] 2 N 20 N3N3 N 14 N 10 [GATA] (a) (b) (c) (d) ATCTATCTTGAATTAATAGATTCAAGGTGATAGATATACAGATAGATAGATA CATAGGTGGAGACAGATAGATGATAAATAGAAGATAGATAGATAGATAGAT AGATAGATAGATAGATAGATAGATAGATAGATAGATA

95 YHRDUS Y-STR 17 Yfiler 12 PPY 11 SWGDAM 9 MHL # Loci in Haplotype # Samples in Database # Loci in Haplotype # Samples in Database samples 8376 samples samples samples samples samples samples 6885 Caucasian (US, Canada, Europe) 6286 African American 3397 Hispanic 983 Native American (Apache, Navajo, Shoshone, Sioux) 996 Asian (Chinese, Filipino, Oriental, S. Indian, Vietnamese) Release samples 17 Yfiler 12 PPY Release Populations (106 countries)

96 M42 M60 RPS4Y (M130) M168 M89 M45 M201 M52 M170 M172 A B C D E E3a F* G H I J2 K* LM N M175 M5 M11 P36 O Q R R1b M9 P* M91 YAP M174 M2 M96 12f2 J LLY22g M207 M173 P25 M269 R1b3 R1

97 Chapter 14 - mtDNA

98 Heavy (H) strand Light (L) strand HV

99 MtDNA Haplotype Groups: 1 2,3,6,8,11,13,15,16 4,9, ,17,18 MtDNA Haplotype Groups: 1 2,3,6,8,11,13,15,16 4,9, ,17,18 A B B C C C D B B B B B B E F G G G

100 HV1HV2 HV /1 342 bp268 bp137 bp F15989 R16251 F16190 R16410 VR1 VR2 C-stretch AFDIL “mini-primer” set PSI (263 bp) PSII (221 bp) F15 R285 F155 R381 PSIII (271 bp) PSIV (227 bp) C-stretch MPS1A (170 bp) MPS1B (126 bp) MPS2A (133 bp) MPS2B (143 bp) MPS3A (126 bp) MPS3B (132 bp) MPS4A (142 bp) MPS4B (158 bp) AFDIL primer set

101 Compare with database to determine haplotype frequency Extract mtDNA from evidence (Q) sample PCR Amplify HV1 and HV2 Regions Sequence HV1 and HV2 Amplicons (both strands) Confirm sequence with forward and reverse strands Note differences from Anderson (reference) sequence Compare Q and K sequences Performed separately and preferably after evidence is completed Extract mtDNA from reference (K) sample PCR Amplify HV1 and HV2 Regions Sequence HV1 and HV2 Amplicons (both strands) Confirm sequence with forward and reverse strands Note differences from Anderson (reference) sequence

102 GAAAAAGTCT TTAACTCCAC CATTAGCACC CAAAGCTAAG ATTCTAATTT AAACTATTCT CTTTTTCAGA AATTGAGGTG GTAATCGTGG GTTTCGATTC TAAGATTAAA TTTGATAAGA CTGTTCTTTC ATGGGGAAGC AGATTTGGGT ACCACCCAAG TATTGACTCA CCCATCAACA GACAAGAAAG TACCCCTTCG TCTAAACCCA TGGTGGGTTC ATAACTGAGT GGGTAGTTGT C C A ACCGCTATGT ATTTCGTACA TTACTGCCAG CCACCATGAA TATTGTACGG TACCATAAAT TGGCGATACA TAAAGCATGT AATGACGGTC GGTGGTACTT ATAACATGCC ATGGTATTTA ACTTGACCAC CTGTAGTACA TAAAAACCCA ATCCACATCA AAACCCCCTC CCCATGCTTA TGAACTGGTG GACATCATGT ATTTTTGGGT TAGGTGTAGT TTTGGGGGAG GGGTACGAAT CAAGCAAGTA CAGCAATCAA CCCTCAACTA TCACACATCA ACTGCAACTC CAAAGCCACC GTTCGTTCAT GTCGTTAGTT GGGAGTTGAT AGTGTGTAGT TGACGTTGAG GTTTCGGTGG T T C G C CCTCACCCAC TAGGATACCA ACAAACCTAC CCACCCTTAA CAGTACATAG TACATAAAGC GGAGTGGGTG ATCCTATGGT TGTTTGGATG GGTGGGAATT GTCATGTATC ATGTATTTCG C CATTTACCGT ACATAGCACA TTACAGTCAA ATCCCTTCTC GTCCCCATGG ATGACCCCCC GTAAATGGCA TGTATCGTGT AATGTCAGTT TAGGGAAGAG CAGGGGTACC TACTGGGGGG TCAGATAGGG GTCCCTTGAC CACCATCCTC CGTGAAATCA ATATCCCGCA CAAGAGTGCT AGTCTATCCC CAGGGAACTG GTGGTAGGAG GCACTTTAGT TATAGGGCGT GTTCTCACGA FBI A1 (L15997) Roche (F15975) HV HVI C-stretch Roche IA Roche ID Roche IC Roche IE HV1 FBI B1 (H16391) Roche (R16418) Hypervariable Region I bp examined SSO Probes Only 9 sites examined

103 GATCACAGGT CTATCACCCT ATTAACCACT CACGGGAGCT CTCCATGCAT TTGGTATTTT CTAGTGTCCA GATAGTGGGA TAATTGGTGA GTGCCCTCGA GAGGTACGTA AACCATAAAA G CGTCTGGGGG GTATGCACGC GATAGCATTG CGAGACGCTG GAGCCGGAGC ACCCTATGTC GCAGACCCCC CATACGTGCG CTATCGTAAC GCTCTGCGAC CTCGGCCTCG TGGGATACAG C T C GCAGTATCTG TCTTTGATTC CTGCCTCATC CTATTATTTA TCGCACCTAC GTTCAATATT CGTCATAGAC AGAAACTAAG GACGGAGTAG GATAATAAAT AGCGTGGATG CAAGTTATAA G C T G ACAGGCGAAC ATACTTACTA AAGTGTGTTA ATTAATTAAT GCTTGTAGGA CATAATAATA TGTCCGCTTG TATGAATGAT TTCACACAAT TAATTAATTA CGAACATCCT GTATTATTAT A ACAATTGAAT GTCTGCACAG CCACTTTCCA CACAGACATC ATAACAAAAA ATTTCCACCA TGTTAACTTA CAGACGTGTC GGTGAAAGGT GTGTCTGTAG TATTGTTTTT TAAAGGTGGT AACCCCCCCT CCCCCGCTTC TGGCCACAGC ACTTAAACAC ATCTCTGCCA AACCCCAAAA TTGGGGGGGA GGGGGCGAAG ACCGGTGTCG TGAATTTGTG TAGAGACGGT TTGGGGTTTT ACAAAGAACC CTAACACCAG CCTAACCAGA TTTCAAATTT TATCTTTTGG CGGTATGCAC TGTTTCTTGG GATTGTGGTC GGATTGGTCT AAAGTTTAAA ATAGAAAACC GCCATACGTG TTTTAACAGT CACCCCCCAA CTAACACATT ATTTTCCCCT CCCACTCCCA TACTACTAAT AAAATTGTCA GTGGGGGGTT GATTGTGTAA TAAAAGGGGA GGGTGAGGGT ATGATGATTA HV HV2 C-stretch Roche IIA Roche IID Roche IIB Roche IIC HV2 FBI D1 (H408) Roche (RR429) FBI C1 (L048) Roche (F15) Hypervariable Region II bp examined SSO Probes Only 9 sites examined

104 HV1 C-stretch 16189T Poor quality sequence (two length variants out of phase) Good quality sequence Primer strategies typically used with C-stretch containing samples (a) (b) (c) C-stretch Use of internal primers Double reactions from the same strand

105 Sample Q 16093C 16129A Sample K 16093C 16129A ACCGCTATGT ATTTCGTACA TTACTGCCAG CCACCATGAA TATTGTACGG TACCATAAAT rCRS ACCGCTATGT ATCTCGTACA TTACTGCCAG CCACCATGAA TATTGTACAG TACCATAAAT Q K (a) mtDNA Sequences Aligned with rCRS (positions ) (b) Reporting Format with Differences from rCRS

106 16093 (C/T)

107 (b) Reported Types K: Q: w 1 IA 12 IC ID IE IIA IIB IIC IID HVIHVII Ref7 K Q (a) “blank”

108 Chapter 15 – X-chromosome

109 XAXA XAXA XAXA XAXA XAXA XAXA XAXA X A or X B XAXBXAXB XAXA XAXA XAXA Half-sisters testing Paternal grandmother- granddaughter Deficiency cases

110 XAYXAYXBXCXBXC X B,C YX A X B,C H1H1 H2H2 X A,B,C X ?

111 Investigator Argus X-12 Kit DXS10079DXS7423DXS10146 ADXS10134DXS7132DXS10103DXS bp 400 bp300 bp200 bp DXS10135DXS10101DXS10074 DXS10148HPRTB PCR product sizes (bp)

112 Chapter 16 – Nonhuman DNA

113 Male cat Female cat SRY (male)

114 Chapter 17 – New Technologies

115

116 (a) Electrophoresis (b) Mass spectrometry (c) DNA sequencing A1G1C4T3A1G1C4T3 ≈9 nucleotides (compared to size standard) A2G3C3T1A2G3C3T Da2640 Da CGCTTTCCAGAATCGGCC ≈9 nucleotides (compared to size standard) (base composition) (base position) (fragment migration)

117 5’-CTATTGC-3’ CAGTTCT Nucleotide added C--GTTTCC-- Nucleotide sequence Signal intensity CAGTTCT Nucleotide added CAGTTTC-- Nucleotide sequence Signal intensity 5’-CTTTGCC-3’

118 Plate sealer Tecan Freedom EVO 150 robotic workstation


Download ppt "Figures for John M. Butler’s Advanced Topics in Forensic DNA Typing: Methodology (2012)"

Similar presentations


Ads by Google