Presentation is loading. Please wait.

Presentation is loading. Please wait.

Is the information you are taught in science class true? Why or why not?

Similar presentations


Presentation on theme: "Is the information you are taught in science class true? Why or why not?"— Presentation transcript:

1 Is the information you are taught in science class true? Why or why not?

2 Almost all aspects of life are engineered at the molecular level, and without understanding molecules we can only have a very sketchy understanding of life itself. – Francis Crick DNA – the molecule of life!

3 The human genome is estimated to contain 20,000 to 25,000 genes. BUT only a few of those genes make us different from one another

4 99% of a Humans and Chimps DNA is the same!

5 Where do we find this DNA?

6 Journal Question: Briefly and simply explain the experiment you were assigned 1. D 2. I 3. B 4. C 5. H 6. E 7. A 8. G 9. F 10. K 11. J 12. M 13. L

7 JQ: What is a gene, and what is its function?

8 Deoxyribonucleic Acid: DNA 1.Structure: DNA- monomers are called nucleotides 2.Monomers pair up and form double helix (twisted ladder shape) 1.Function: DNA is responsible for your traits, from personality to physical appearance

9 Essential Concept: How does DNA produce your traits? DNA makes proteins, and proteins do all the work in your cells DNA contains segments called Genes Genes are recipes for proteins Proteins do all of the cell’s work: -building cells -repairing cells -movement -defense

10 One cell contains about 6 feet of DNA.

11 JQ: Describe these features below using the diagram with the person next to you. 1.Nucleotide 2.Phosphate 3.Deoxyribose sugar 4.Hydrogen Bonding 5.Purine 6.Pyrimidine 7.3’ end / 5’ end 8.Antiparallel

12 Up until the mid-1900’s, many scientists believed that protein was the heritable material ( chemical instruction manual for living things) HOW DO WE KNOW DNA IS LIFE’s BLUE PRINT??? VS. PROTEIN DNA

13 Frederick Griffith’s Transformation Experiment 1928 - Griffith worked with two strains of a pneumonia bacterium A. an “S” strain - covered by capsule (“smooth strain”) - deadly B. “R” strain (“Rough strain”) - no capsule - not deadly Injected mice with S and R strains under 4 conditions: PREDICTIONS?? Living S cells (control) Living R cells (control) Heat-killed S cells (control) Mixture of heat-killed S cells and living R cells Mouse dies Living S cells are found in blood sample Mouse healthy Mouse dies RESULTS Heat-killed SS-strain R-strain Heat-killed S mixed with R

14 Frederick Griffith’s Conclusions?????? Living S cells (control) Living R cells (control) Heat-killed S cells (control) Mixture of heat-killed S cells and living R cells Mouse dies Living S cells are found in blood sample Mouse healthy Mouse dies RESULTS Something in the dead S-strain (deadly) “transformed” the R- strain (not deadly), and the R-strain now killed the mouse DOES THIS PROVE THAT DNA IS THE HERITABLE MATERIAL? NO, but supports idea that molecules from “S” genetically transformed “R”

15 Avery’s Experiment ►RNase destroys RNA, DNase destroys DNA, Lipase destroys Lipids, Protease destroys Proteins, and Carbo-ase destroys carbs ►Avery took Griffith’s experiment one-step further. CAN YOU EXPLAIN WHAT HE DID? What can we assume is happening in “3” 1 2 3 4

16 Avery’s Transformation Experiment ►HYPOTHESIS: DNA causes transformation…it is the heritable material ► Avery took five test tubes with S strain (deadly strain), each had DNA, RNA, carbs, lipids, proteins in them ►Added enzyme to destroy one type of each macromolecule to each test tube ►Add enzyme-treated S-strain to R-strain beakers ----WHY? ►Based on hypothesis, which beakers are predicted to transform? 1 2 3 4

17 Up until the mid-1900’s, many scientists believed that protein was the heritable material ( chemical instruction manual for living things) Check Yourself Before you Wreck Yourself: 1. What is a gene? 2. What does DNA code for? 3. What is the monomer unit of Nucleic Acids? 4. Describe the results and conclusion for Griffith’s experiment. 5. Describe the results and conclusion for Avery’s experiment

18 Up until the mid-1900’s, many scientists believed that protein was the heritable material ( chemical instruction manual for living things)

19 Life Cycle Of T2 Phage Virus What does the virus inject into the E. Coli Cell? What stays on the outside?

20 Centrifuge Centrifuge? Uses centrifugal force to separate substances by density Inside rotates so fast that it causes thousands of times the force of gravity on earth Outside of cells cells

21 Hershey-Chase Experiment ►In 1952, Hershey and Chase used radioactive elements to label DNA and Proteins in Phage Viruses ►Batch 1: Used radioactive Sulfur: Colored Protein ►Batch 2: Used Radioactive Phosphorus: Colored DNA? ►In each batch, they infected E. Coli bacteria with Phage T2 virus, ►WHERE SHOULD THEY OBSERVE THE RADIOACTIVE Sulfur? Phosphorus? Inside or outside the bacterial cell? ►Why did they centrifuge the E. coli/virus mixture? What’s on the bottom of the centrifuged tube? On top (in supernatant)? Bacterial cell Phage DNA Radioactive protein Empty protein shell Phage DNA Radioactivity (phage protein) in liquid Batch 1: Sulfur ( 35 S) Radioactive DNA Centrifuge Pellet (bacterial cells and contents) Pellet Radioactivity (phage DNA) in pellet Centrifuge Batch 2: Phosphorus ( 32 P)

22 Hershey-Chase Experiment ►Batch 1: Radioactive protein shell found in supernatant (liquid) ►Interpret Results? ►Protein never entered the E. Coli (not involved in replication) ►Batch 2: Radioactive DNA found in pellet? ►Interpret Results? ►DNA entered the E. Coli (Used to make more E. Coli) ►Conclusion: DNA is heritable material Bacterial cell Phage DNA Radioactive protein Empty protein shell Phage DNA Radioactivity (phage protein) in liquid Batch 1: Sulfur ( 35 S) Radioactive DNA Centrifuge Pellet (bacterial cells and contents) Pellet Radioactivity (phage DNA) in pellet Centrifuge Batch 2: Phosphorus ( 32 P)

23 Additional Evidence That DNA Is the Genetic Material  1947 - Chargaff proposed that, within an organism: # Adenine = # Thymine # Cytosine = # Guanine  (A=30.9% and T=29.4%; G=19.9% and C=19.8% in humans)  Interpretation of Chargaff’s rule?

24 Additional Evidence That DNA Is the Genetic Material Rosalind Franklin’s X-ray crystallography images allowed scientists to figure out DNA was double helix

25 James D. Watson & Francis H. Crick Watson and Crick used information from Chargaff and Franklin to solve the structure of DNA

26 1962: Nobel Prize in Physiology and Medicine James D. Watson What about? Rosalind Franklin Watson, J.D. and F.H. Crick, “Molecular Structure of Nucleic Acids: A Structure for Deoxynucleic Acids”. Nature 171 (1953), p. 738.

27 Up until the mid-1900’s, many scientists believed that protein was the heritable material ( chemical instruction manual for living things)

28 JQ: Describe these features below using the diagram with the person next to you. 1.Nucleotide 2.Phosphate 3.Deoxyribose sugar 4.Hydrogen Bonding 5.Purine 6.Pyrimidine 7.3’ end / 5’ end 8.Antiparallel

29 Up until the mid-1900’s, many scientists believed that protein was the heritable material ( chemical instruction manual for living things)

30 Human Microbiome Article

31 JQ: Use the following terms in a short paragraph: Nucleotide, gene, DNA, trait, protein, nitrogenous bases, monomers, polymer.

32 Journal Question: Using your smart phone or text book, look up a specific name of an enzyme, then answer the questions below. What is it called? What is its job?

33 What is an enzyme? Specialized proteins that speed up the rate of a chemical reactions in organisms For Example: 1.Sucrase turns sucrose into glucose and fructose 2.Amylase turns starch into glucose 3.Lysozyme destroys the cell wall of bacteria, preventing infection.

34 Structure of an Enzyme Active Site – for attaching onto reactants aka substrates The chemical(s) that enzyme attaches to is called the substrate. Highly specific with what they bind onto. Lock and Key analogy

35 Analogies for Enzymes Mentos and Diet coke Active site? _______ Substrate? _______ Stapler analogy Active site? _______ Substrate? _______ link

36 Essential Concept: Enzymes are involved in almost every cellular process, including DNA replication Read pages 300 - 303 in your text book, and answer questions 1, 2, 5 on pages 303

37 Each type of enzyme requires specific conditions in order to work properly. Factors like pH, temperature, and amount of positive or negative charges affect enzyme function Denature – when a protein (like an enzyme) changes shape, and stops working properly, due to change conditions around the enzyme.

38 pH Scale: Acids and Bases Acids: When placed in water, an acid releases H+ (hydrogen) ions Bases: When placed in water, a base will release OH- (hydroxide) ions The pH scale compares substances to one another based upon how acidic or basic they are.

39 A.At what pH does salivary amylase function best? B.In what organ do you think pepsin is found? C.At what pH do Salivary Amylase and Arginase have the same rate of activity? Journal Question: Answer the following three ?’s

40 Why is it so important for you to sweat? What would happen if you couldn’t? Use the terms Homeostasis, Proteins, Enzymes, and Denature in your answer.

41 If you have the knowledge and ability to heal people you should do it! Agree or Disagree?

42 With something so small how is it possible to pull it out and look at it? Extraction

43 JQ: What are three things that you are thankful for? Explain.

44 One cell contains about 3 meters of DNA.

45 If you were to unravel all of your DNA it would stretch from here to the moon thousands of times over.

46 How does it all fit into the nucleus of a cell?

47 Can you calculate how many times your DNA can go to the sun and back? Givens: We have 70,000,000,000,000 cells Each has 6 feet of DNA The sun is 92 million miles away Each mile has 5,280 feet Annnnnddddd…….go.

48 70,000,000,000,000 cells 6 ft. DNA 1 mile 1 trip to sun 1 cell 5,280 feet 92,000,000 miles = 864 trips to the sun, which means 432 trips to the sun and back! The Derivation

49 JQ: Use the following terms in a short paragraph: Nucleotide, gene, DNA, trait, protein, nitrogenous bases, monomers, polymer.

50 Building Models of DNA 1.Working in groups of 4 read through the introduction to learn about the structure & function of DNA. 2.Answer pre-lab questions. 3.Once finished obtain a K’nex set and build your DNA models. 4.Clean up and return to seats.

51 DNA Model 1.Monomer – 3 parts 2.Sides vs. Center 3.Complimentary Bases 4.Hydrogen Bonding 5.# of DNA strands 6.Antiparallel 7.Helix 8.Function 9.Genes

52 JQ: See Below JQ: By this point, you may know that you are composed of trillions of cells, all doing slightly different jobs, all under the direction of 23,000 or so genes, right? Are you one organism, or more of a colony of many smaller organisms? (opinion) Explain.

53 JQ: Should humans be allowed to tinker with the DNA code in any organism? Explain.

54 NO Journal Questions Today! Pull out your DNA K’Nex Packets.

55 Building Models of DNA 1.Working in groups of 4 complete the construction of your DNA model (if not already complete) 2.Answer post lab questions. 3.Study model and be able to describe to the teacher how it is constructed 4.Break down model and put pieces back in box. 5.Return to seats.

56 JQ: What is a gene, and what is its function?

57 DNA Model 1.Nucleotide 2.Phosphate 3.Deoxyribose sugar 4.Hydrogen Bonding 5.Purine 6.Pyrimidine 7.3’ end 8.5’ end 9.Antiparallel

58 The combination of nitrogen bases (A,T,C,G) is the code that is found in a gene. That sequence determines the type of protein made. DNA Code Exon 1 Exon 2 Intron

59 Looking at the DNA strand below, write out its compliment: ATGCTTACGACTACACGGGATACAT T ACGAATGCTGATGTGCCCTATGTAY Gene - Exon

60 e? What do the proteins in the cells create?

61

62 Transgenic Zebra Fish Reading 1.Actively read through the article: Glowing Fish – First Genetically Modified Organism Available as a Pet 2.Answer Reading Questions 3.Class Discussion

63 JQ: If you were to create a fluorescent transgenic human, what would you want to trigger the glowing sensation? Explain.

64 Transgenic Zebra Fish Reading 1.Zebra Fish vs. GloFish? 2.Transgenic? 3.Promotor? 4.Creating Transgenic? 5.Estrogen vs. Stress Induced Promotors? 6.Ethical Issues? 7.Avatar?

65 How Did Scientists Engineer the Transgenic Glowfish? Glo Gene: DNA code for glowing protein ATCCTAGTATA Normal Zebrafish DNA : AGTTATGACCTCA TTCAGCGTATCT Transgenic Glofish! ATCCTAGTATA

66 Using Glofish to study water pollution Promoter: TATAGCTAGCC DNA code before gene turns gene on or off Normal Zebrafish DNA : AGTTATGACCTCATTCAGCGTATCT Glofish Glows! ATCCTAGTATA AGTTATGACCTCATTCAGCGTATCT Glofish doesn’t glow ATCCTAGTATA

67 Up until the mid-1900’s, many scientists believed that protein was the heritable material ( chemical instruction manual for living things)

68 If you could take the best of you and your mate to make a child, would you do it? What if everyone in the world was doing the same thing? 1.Watch the movie and answer movie questions. 2.Enjoy and imagine the possibilities.

69 JQ: If you had the choice, would you create a designer baby? Explain.

70 GATTACA Movie Questions 1.What is an invalid? 2.How does the world view invalids? Why? 3.Why does Jerome help Vincent? 4.What ultimately happens with Anton’s life? 5.Why does Lamar help Vincent at the end of the movie? 6.What is the problem with the world of GATTACA?

71 Bringing It All Together Challenge Pair & Share Activity Using the following terms see if you can link them all together to tell a story about how to build an organism. Write your answer in paragraph form. Terms to use in paragraph: Multicellular organism, tissue, organelle, cell, stem cells, differentiate, organ, atom, water, biomolecules, organ systems, DNA, dehydration synthesis, hydrolysis.

72 Multicellular organisms are complex organisms made from many different layers. The smallest layers is made out of atoms. Atoms are then used to make biomolecules. While making and using these biomolecules water is necessary to do so. Through dehydration synthesis you can build biomolecules and through hydrolysis you can break them down. Biomolecules are used to build organelles, which are tiny organs that are used to build a cell. How the cell is built, is entirely dependent on the DNA sequence found within the Nucleus. Once a cell is built it normally starts off as a stem cell, which means it doesn’t have a job yet. Eventually the cell will differentiate into a specific type of cell. Once there is a bunch of cells of the same type they will form into a tissue. There are four types of tissues. Those tissues will then be used to make a specific organ. When a bunch of similar organs are made and group together, they will form an organ system. Those organ systems will then be used to construct the multicellular organism.

73 Constructing an Avatar Mid-Term Project 1.Read through project description. 2.Discuss expectations as a class. 3.Gather into groups and begin brainstorming. Think about our pair and share today and being working at the smaller level.

74 Review Topics for Quiz – Please Copy Down 1.Properties of water: polarity, adhesion, cohesion and capillary action. 2.DNA: structure and function a.Nucleotides (phosphate, deoxyribose sugar, nitrogen bases) b.Sides vs. Center c.Hydrogen Bonding d.Complimentary Bases e.Antiparrallel f.Genes g.Introns & Exons 3. Function of DNA

75 JQ: Who has bigger cells, an Avatar or a human? Explain.

76 What is DNA replication? Replication is the process where DNA makes an exact copy of itself. Why does DNA replicate?

77 Original DNA Building Blocks for new DNA (Nucleotides) DNA Helicase (Protein) DNA Polymerase (Protein) 2 identical pieces of DNA

78 DNA Replication Steps 1.DNA Helicase (enzyme) splits open double strand right through hydrogen bonds in the middle. 2. DNA Polymerase (enzyme) attaches free floating nucleotides to the open strands, making sure to proofread along the way. 4. End product is two identical strands of DNA. 3. Single-Stranded Binding Protein holds two strands apart, so they don’t reattach to one another.

79 DNA Helicase (Protein) DNA Polymerase (Protein)

80 DNA Replication Steps (more) 1.DNA Polymerase can only read the open DNA strand in one direction. 2. DNA Polymerase (enzyme) attaches free floating nucleotides to the open strands, making sure to proofread along the way. 4. End product is two identical strands of DNA. 3. Single-Stranded Binding Protein holds two strands apart, so they don’t reattach to one another.

81 DNA Replication in REAL Time

82 Exploring the use of Protein Worker Molecules 1.Read through lab procedures. 2.Find a partner, gather materials and begin lab. 3.Answer post lab questions. 4.Clean up and return to seats.

83 NO Journal Question Today! Take some time to review for your test! You will need a pencil.

84 Toothpickase Post Lab Discussion 1.What is the purpose of an enzyme? 2.What happens when you alter the environment of an enzyme? 3.What happens when you alter the active site of an enzyme?

85 H 2 O + CO 2 H 2 CO 3 ReactantsProduct What is an enzyme? Specialized proteins that speed up the rate of a chemical reaction by lower its activation energy.

86 What are Chemical Reactions? The making and breaking of bonds between different chemicals.

87 2H 2 + O 2 2H 2 O ReactantsProducts The # of hydrogen and oxygen remain the same. They are just grouped differently.

88 All chemicals contain energy Amount of energy depends on the structure of the molecules

89 H 2 + O 2 H 2 O ReactantsProducts Energy-Absorbing Reaction Synthesis Activation energy Reactants Products Energy-Absorbing Reaction

90 Potential Energy Energy at rest. Stored Energy.

91 H 2 + O 2 H 2 O ReactantsProducts Energy-Releasing Reaction Decomposition Energy-Releasing Reaction Products Activation energy Reactants

92 Kinetic Energy Energy in motion. Releasing energy.

93 Reactants Products AE w/o Enzyme AE w/ Enzyme Reaction pathway with enzyme Reaction pathway w/o enzyme

94 Structure of an Enzyme Active Site – for binding onto reactants aka substrates Highly specific with what they bind onto. Lock and Key Mechanism

95 Uses in the Cell Regulating chemical pathways Making materials that cells need Releasing energy Transferring information

96 JQ: Why does your body sweat & shiver? Okay I know what you will say, “to regulate body temperature.” That is true, but why must you do that?

97 Cell Cycle! Making new cells.

98 Why do cells divide instead of continually growing?

99 Large cells require to many proteins to be made at the same time. DNA cannot keep up. 1. DNA Overload

100 Big cells demand more nutrients and produce more waste, but do not have enough roadways to get the nutrients in and waste out efficiently. 2. Supply and Demand Issues

101 Let’s take a look at the life cycle of a somatic cell!

102 1.All body cells except sperm or egg cells 2. Somatic cells are Diploid Cell What is a somatic cell?

103 # of sets# of DNA pieces in each set What is a diploid cell?

104 N = 23; 23 pieces from MOM & 23 from DAD What would a human somatic cell look like?

105 Dad’s & Mom’s Chromosomes are homologous – meaning they match up. Dad’s Chromo.Mom’s Chromo Eye Color Gene Blue Eyes Brown Eyes What is unique about mom and dads chromosomes?

106 Karyotype – shows an organism’s homologous chromosomes in order How is this karyotype different from the first?

107 How does the cell cycle work? 1.With your descriptions & pictures match them up and then put them in the correct order. 2.Get teachers approval. 3.Create a title page on notecards. 4.Glue pictures & descriptions in booklets. 5.Staple booklets.

108 Watch the following video and then answer the following journal question. J Q: Would you quit or would you persevere? Explain.

109 What does a typical day look like for a cell? When does a cell divide, and is it the same for ever cell?

110 Cell TypeLife SpanCell Division Red Blood CellLess than 120 days NO Skeletal MuscleLong-livedNO Lining of Esophagus2-3 daysYes Stomach Cell2 daysYes Nerve CellLong Lived??Most Do Not Sperm Cell2-4 days after ejaculation Yes How long do certain cells live within your body?

111 How does a cell know when to divide? Ever cell contains proteins called cyclin which monitors external and internal activity, and communicate to cells when it is time to make a new.

112 What does the cell cycle look like? 2 Parts: Interphase & M-phase Cell Cycle Visual Non-Audio Version M-phase

113 Cell expands, proteins & organelles are made (G1 phase) DNA replicates (s-phase) Equipment (centrioles) needed for DNA separation is made (G2 phase) Part 1: Interphase – Cell Growth & Preparation

114 Part 2: M-phase – Division of Nucleus & Cytoplasm Mitosis is the division of the nucleus (DNA). Cytokinesis is the division of the cytoplasm (cell).

115 How does Mitosis work? 4 Steps 1.P rophase 2.M etaphase 3.A naphase 4.T elophase

116 Replicated DNA pieces & attach together to form a chromosome (humans 46) Nucleus disappears Centrioles move to opposite sides of the cell and form spindle fibers. Prophase

117 Centrioles throw out spindle fibers from both ends of the cell which attach to the centers of all chromosomes. Tension is applied to spindles & chromosomes are lined up across the middle of the cell. Humans 46 lined up. Metaphase

118 Centrioles pull spindle fibers toward themselves, separating chromosomes into individual pieces of DNA. Humans 46 on each side of the cell. Anaphase

119 DNA loosens up. Nucleus reforms around both sets of DNA. Spindle fibers disappear. Telophase

120 Animal cell – cell membrane pinches in forming a cleavage furrow = 2 new cells How does cytokinesis work? Plant cell – cell plate (membrane & wall) forms between two cells = 2 new cells

121

122 How long does it take to make a new cell?

123 Watch the following video and enjoy!

124 Review for Project 1.DNA microinjection 2.Determining if cells are reproducing properly. 3.Stem cell differentiation? 4.Organ Development 5.Real World Applications 6.Mind Control Article

125 Monkey Controlling Robot with Mind Article 1.Actively read through article. 2.Answer post reading questions. 3.Discuss as a class.

126 P53 Homework is to play and complete the Cyclin Challenge Game

127 JQ: Do children really need parents? Explain.

128 P53 Cyclin & CDK the protein supervisors of the cell cycle!

129

130 Retinal Cancer Frightening or a Great Fashion Statement?

131 Cancer is the uncontrolled cell growth of abnormal cells in the body. What is cancer?

132 How do cells become abnormal? 1 st DNA becomes mutated due to: DNA miscopying Food, UV Rays, Tobacco products, viruses, non-stick pans, hand sanitizers, chemical carcinogens

133 2 nd mutation causes cell to lose its ability to start and stop cell replication. Cyclin is Sleeping

134 3 rd continual cell growth will lead to a mass of cells called a tumor.

135 What types of tumors exist?

136 Fast growing and are likely to spread to other parts of the body and cause problems (metastasize) Malignant Tumors

137 Slow growing and do not metastasize. ISOLATED Benign Tumors

138

139

140

141

142

143

144

145

146

147

148

149

150

151

152 Upcoming Quest Topics DNA Replication, Enzymes and Cell Cycle Work on your review sheet to begin preparing for your quest.

153 JQ: Take a few minutes to organize yourselves for your presentation! Good Luck! Order of Lab Tables: 2 6 5 3 1 4


Download ppt "Is the information you are taught in science class true? Why or why not?"

Similar presentations


Ads by Google