Presentation is loading. Please wait.

Presentation is loading. Please wait.

CH 10 DNA, RNA, AND PROTEIN SYNTHESIS. REVIEW  What did Mendel tell us about heredity?  Did he know what was being transmitted?  This chapter will.

Similar presentations


Presentation on theme: "CH 10 DNA, RNA, AND PROTEIN SYNTHESIS. REVIEW  What did Mendel tell us about heredity?  Did he know what was being transmitted?  This chapter will."— Presentation transcript:

1 CH 10 DNA, RNA, AND PROTEIN SYNTHESIS

2

3 REVIEW  What did Mendel tell us about heredity?  Did he know what was being transmitted?  This chapter will help us identify the structure, and function of DNA.

4 10-1 DISCOVERY OF DNA 10-2 STRUCTURE OF DNA YEARSCIENTISTConclusion 1928Frederick Griffith 1940’sOswald Avery 1952Hershey & Chase 1953Watson & Crick early 1950s Rosalind Franklin 1949Erwin Chargaff SKIP 2-3 lines between rows.

5 GRIFFITH’S EXPERIMENT 1928 Britain Studied Streptococcus pneumoniae Trying to develop a vaccine Identified two strains 1.virulent: disease causing  Colonies with smooth edges (S strain) 2.non-virulent  Colonies with Rough edges (R strain)

6

7 10-1 DISCOVERY OF DNA 10-2 STRUCTURE OF DNA SCIENTISTConclusion Frederick Griffith  Virulent bacteria released ‘hereditary factor’ that transformed the non-virulent bacteria  Transformation: movement of genetic material from one organism to another Oswald Avery Hershey & Chase Watson & Crick Rosalind Franklin Erwin Chargaff

8 DNA “ Heredity factors” = genes Genes are located on DNA molecule

9 AVERY’S EXPERIMENTS Is transforming agent protein, RNA, or DNA??? Used R and S strains on mice again.

10 10-1 DISCOVERY OF DNA 10-2 STRUCTURE OF DNA SCIENTISTConclusion Frederick Griffith  Virulent bacteria released ‘heredity factor’ that transformed the non-virulent bacteria  Transformation: movement of genetic material from one organism to another Oswald AveryDNA is responsible for transformation in bacteria. Hershey & Chase Watson & Crick Rosalind Franklin Erwin Chargaff

11 HERSHEY-CHASE EXPERIMENT Bacteriophage: virus that infects bacteria

12 Is DNA or protein the hereditary material viruses transfer when they infect a bacterial cell? All viral DNA entered bacterial cell. Very little protein entered.

13 10-1 DISCOVERY OF DNA 10-2 STRUCTURE OF DNA SCIENTISTConclusion Frederick Griffith  Virulent bacteria released ‘heredity factor’ that transformed the non-virulent bacteria  Transformation: movement of genetic material from one organism to another Oswald AveryDNA is responsible for transformation in bacteria. Hershey & ChaseDNA is the hereditary molecule in viruses, not protein. Watson & Crick Rosalind Franklin Erwin Chargaff

14 10-2 DNA STRUCTURE 1953 Watson and Crick identified the 3-D structure of DNA

15 Rosalind Franklin  Female scientist  Crucial final clue  X-Ray diffraction technique

16 10-1 DISCOVERY OF DNA 10-2 STRUCTURE OF DNA SCIENTISTConclusion Frederick Griffith  Virulent bacteria released ‘heredity factor’ that transformed the non-virulent bacteria  Transformation: movement of genetic material from one organism to another Oswald AveryDNA is responsible for transformation in bacteria. Hershey & ChaseDNA is the hereditary molecule in viruses, not protein. Watson & CrickDNA’s structure is a “double helix”  (2 strands of nucleotides twisted in a spiral shape) Rosalind FranklinShape of DNA Erwin Chargaff

17 DNA made of 2 chains that wrap around each other to form a double helix

18 DNA NUCLEOTIDES MONOMER of nucleic acids Three components  5-Carbon sugar  Phosphate group  Nitrogenous base

19 DNA DOUBLE HELIX 2 strands of DNA likened to a twisted ladder Nitrogenous bases = “rungs” Held together with H-Bonds between complementary nitrogenous bases Sugar and phosphate compose “backbone” or “handrails”

20 NITROGENOUS BASES Only 4 1.Adenine (A) 2.Guanine (G) 1.Thymine (T) 2.Cytosine (C) Double ringed: Purines Single ringed: Pyrimidines

21 COMPLEMENTARY BASES 1949; Erwin Chargaff %A = %T %G = %C A DENINE always bonds with T HYMINE G UANINE always bonds with C YTOSINE Nitrogenous bases are complementary to each other What is the complementary strand to ATTG?

22 10-1 DISCOVERY OF DNA 10-2 STRUCTURE OF DNA SCIENTISTConclusion Frederick Griffith  Virulent bacteria released ‘heredity factor’ that transformed the non-virulent bacteria  Transformation: movement of genetic material from one organism to another Oswald AveryDNA is responsible for transformation in bacteria. Hershey & ChaseDNA is the hereditary molecule in viruses, not protein. Watson & CrickDNA’s structure is a “double helix” (2 strands of nucleotides twisted in a spiral shape) Rosalind FranklinShape of DNA Erwin ChargaffBase-pairing rule A – T C - G

23 What is the complementary strand to A C C T G T G A G A C G?

24 QUIZ NEXT CLASS MATCH THE FOLLOWING SCIENTISTS TO THEIR WORK Frederick Griffith Hershey & Chase Watson & Crick Erwin Chargaff Structure of a NUCLEOTIDE Structure of DNA Purines vs. pyrimidines Complelementary bases

25 10-3 DNA REPLICATION Process by which DNA is copied In nucleus During s phase of cell cycle prior to mitosis Two strands of DNA separate Each strand serves as a template(?) for new strand

26

27 STEPS 1.DNA unwound by helicase  Helicase moves along DNA & breaks H-bonds b/w bases

28

29 STEPS continued… Nucleotides floating in nucleus DNA Polymerase adds complementary nucleotides to original strand Covalent bonds b/w sugar and phosphates of adjoining nucleotides Hydrogen bonds b/w bases

30

31

32 STEPS DNA Polymerase finishes and releases DNA strands 2 identical DNA strands result

33 DNA REPLICATION http://www.youtube.com/watch?v=yqESR7E4b_8

34 DNA REPLICATION REVIEW ATC GTC GAT GTA AGG 1.Identify the complementary bases first 2.Divide the two strands using one color 3.Using a second color, identify the new complimentary strand

35 ERRORS IN REPLICATION Normally very accurate  One error per 1 billion nucleotides DNA polymerase can proofread DNA for mistakes  When found, mistake is corrected Mutation: change in nucleotide sequence of a DNA molecule

36 CANCER Mutation in genes that control cell division can result in uncontrolled cell growth (cancer) Tumor: abnormal mass of cells

37 PROTEIN SYNTHESIS Flow of genetic information: Genes in DNA are TRANSCRIBED into mRNA in the nucleus mRNA is TRANSLATED in cytoplasm into a sequence of amino acids (protein) DNA  RNA  protein transcription translation

38 RNA DNA = DEOXYribonucleic acid RNA = ribonucleic acid Differences (3) 1.Sugar:  RNA = ribose  DNA = deoxyribose 2.Shape:  RNA = single stranded  DNA = double stranded 3.Nitrogenous bases  In RNA, replace thymine with Uracil (U)

39 TYPES OF RNA 1.Messenger RNA (mRNA)  Single stranded  Carries instructions from a gene (DNA) to make protein to ribosome 2.Ribosomal RNA (rRNA)  Composes ribosome 3.Transfer RNA (tRNA)  Transfers amino acids to ribosome

40

41 TRANSCRIPTION Process by which genetic instructions in a specific gene are re-written into mRNA In nucleus 1.RNA polymerase binds to promoter  Enzyme forms RNA on a DNA template Promoter: specific sequence of nucleotides that initiates transcription

42 TRANSCRIPTION 2. RNA polymerase adds free RNA nucleotides that are complementary to template strand of DNA - Remember: in RNA, replace thymine with uracil DNA strand: ATCGAC mRNA strand: UAGCUG DNA  ATCGGATTACA mRNA  UAGCCUAAUGU

43 TRANSCRIPTION RNA pol reaches termination signal Releases both DNA and new mRNA transcript

44

45 TRANSCRIPTION AND TRANSLATION http://www.youtube.com/watch?v=41_Ne5mS2ls

46 BELLWORK ASSIGNMENT Take out your notes, draw, and fill in the table below TranscriptionDNA replication Enzyme used Polymer made Number of template strands

47 TranscriptionDNA replication Enzyme usedRNA polymeraseDNA polymerase Polymer madeRNADNA Number of template strands OneTwo

48 DNA  RNA  PROTEIN Up until now we’ve gone from DNA to mRNA through transcription Now, we are going to translate the code in the mRNA into a sequence of amino acids We are changing the language. Hence the name: Translation

49 THE GENETIC CODE Genetic code: the rules that relate how a sequence of nitrogenous bases corresponds to a particular amino acid Nucleotides are read three nucleotides at a time to code for an amino acid Codon: three-nucleotide sequence in mRNA that encodes an amino acid

50

51 DECODING DNA 64 codons 20 amino acids Some amino acids are coded by 2, 3, or 4 codons Start codon: AUG (indicates where translation should begin)  Code for Methionine (Met) Stop codons (there are 3) end translation  Do not code for an amino acid

52 PAGE 207 IN YOUR BOOK

53 TRANSLATION PRACTICE Translate the following sequences of mRNA (write the first three letters of the amino acid: Methionine = Met) AUG-AAA-GGG-UGA Met- Asp- Gly AUG-CGU-GCA-UGC- CGU-GCA-UGA-UUG-C Met- Arg- Gly- Cys- Arg- Ala AG-AUG-AAG-CUG-CAU-GCA-UGC-UAG-U Met-Lys- Leu-His- Ala- Cys

54 AUG-CGU-GGG-GUA-UAA Met- Arg- Gly- Val- UGAUGGAUGAAACCUGAGGU Met-Asp-Glu-Thr

55 TRANSLATION Where? cytoplasm 5 steps 1. Ribosome attaches to mRNA at AUG tRNA anticodon attaches to complementary mRNA codon Anticodon: sequence of 3 nucleotides on tRNA that are complementary to the mRNA codon First amino acid: Methionine

56 TRANSLATION 2. Next tRNA comes in and binds to codon Peptide bond forms b/w Methionine and next amino acid Ribosome moves to next codon

57 TRANSLATION 3. First tRNA detaches and leaves Met behind Ribosome continues to move down and elongation of polypeptide chain continues to grow

58 TRANSLATION 4. Process ends when ribosome reaches a stop codon

59 TRANSLATION 5. dissasembly: ribosome complex falls apart

60 Several ribosomes translate the same mRNA at the same time

61

62 TRANSCRIPTION AND TRANSLATION http://www.youtube.com/watch?v=41_Ne5mS2ls


Download ppt "CH 10 DNA, RNA, AND PROTEIN SYNTHESIS. REVIEW  What did Mendel tell us about heredity?  Did he know what was being transmitted?  This chapter will."

Similar presentations


Ads by Google