Presentation is loading. Please wait.

Presentation is loading. Please wait.

Simple Animals, Complex Genomes Comparative genomics of sponges, sea anemones, and multicellular pancakes Mansi Srivastava Rokhsar Lab, Department of Molecular.

Similar presentations


Presentation on theme: "Simple Animals, Complex Genomes Comparative genomics of sponges, sea anemones, and multicellular pancakes Mansi Srivastava Rokhsar Lab, Department of Molecular."— Presentation transcript:

1 Simple Animals, Complex Genomes Comparative genomics of sponges, sea anemones, and multicellular pancakes Mansi Srivastava Rokhsar Lab, Department of Molecular and Cell Biology, UC Berkeley Reddien Lab, Whitehead Institute for Biomedical Research

2 Outline 1.Introduction 2.Insights from genomic analyses 3. Linking genomic complexity to biological complexity

3

4 CNIDARIANS PLACOZOAN S SPONGES What is the genomic basis for the difference in complexity? BILATERIANS ? bilateral symmetry, centralized nervous system true muscle true gut nervous system tissue grade multicellularity

5 Three species were selected for genome sequencing SEA ANEMONESPONGEPLACOZOAN

6 Nematostella vectensis is a sea anemone (Finnerty et al. 2004) Nematostella is a great lab rat

7 Trichoplax is a placozoan (photo credits: Ana Signorovitch, Michael Eitel, Bernd Schierwater)

8 Amphimedon queenslandica is a sponge Adult Larvae (photo credits: Bernie Degnan)

9 ATTTGCATGCGTAATTCAAT CGTAATTCAATGTGTGATTC ATTTGCATGCGTAATTCAAT CGTAATTCAATGTGTGATTC ATTTGCATGCGTAATTCAATGTGTGATTC These animal genomes have been sequenced using a Whole Genome Shotgun strategy

10 Nematostella (cnidarian) Trichoplax (placozoan) Amphimedon (sponge) Human C. elegans (nematode) Drosophila (fruit fly) Genome size (Mb) , Gene Models~18,000~11,500~24,000~20,000 ~14,000 Genome Genes Proteins These animal genomes have different sizes, but the numbers of genes/proteins are in the same ballpark exonintron

11 Before comparing their genomes, we need to know how these animals are related to each other and to us BILATERIANS ** ** Not an ancient animal geneAncient animal gene Lost in sponges **

12 Orthologous protein sequences can reveal how organisms are related to each other mouse humanfishfly Live birth, hair, warm blood, four chambered heart vertebrae MTLPDCMW RKLPDCMWPIDWDCMWRLKMTPIR MTLPDCMW RKLPDCMWPIDWDCMWRLKMTPIR

13 Placozoans represent a sister lineage to cnidarians and bilaterians Bilateria Cnidaria Animals

14 CNIDARIANS PLACOZOAN S SPONGES Whole-genome data can resolve early animal relationships BILATERIANS multicellularity bilateral symmetry, centralized nervous system true muscle true gut nervous system tissue grade

15 Previously, some developmental processes were thought to be conserved in the bilaterian ancestor A-P patterning Hox complex Gene structure or genome organization (except for the Hox cluster) were not known to be ancient

16 How do the structures of genes compare between animal genomes? Genome Genes Proteins exonintron

17 Sea anemones, placozoans, and sponges have preserved many (>80%) ancient introns (in collaboration with Uffe Hellsten) (this is not the case for flies and nematodes, which have lost a majority of ancestral metazoan introns)

18 What about how genes are organized relative to each other?

19 The positions of orthologous genes can be compared between two species

20 Gene order conservation decreases with evolutionary distance Synteny “same thread” genes present on the same chromosome

21 No chromosome scale synteny is observed between vertebrates and flies Drosophila Human

22 Nematostella, Trichoplax, and Amphimedon scaffolds show conserved synteny with human chromosome segments (Nik Putnam)

23 There is considerable scrambling of gene order in these blocks of conserved synteny (Nik Putnam)

24 What is the significance of this conserved synteny?

25 Another way to compare genomes is in terms of gene content…

26 Trichoplax has genes for neurons and epithelial cells

27 Trichoplax has genes for developmental signaling pathways

28 Early animal lineages may lack certain cell types or biological processes, but their genomes encode the proteins required for these in bilaterians

29 Many “important” genes are involved in processes essential for animal multicellularity Six hallmarks of animal multicellularity: 1.Regulated cell cycle and growth 2.Programmed cell death 3.Cell-cell and cell-matrix adhesion 4.Allorecognition and innate immunity 5.Specialization of cell types 6.Developmental signaling

30 Comparing early animal genomes allows us to study the temporal origins of animal biology Six hallmarks of animal multicellularity: 1.Regulated cell cycle and growth 2.Programmed cell death 3.Cell-cell and cell-matrix adhesion 4.Developmental signaling 5.Allorecognition and innate immunity 6.Specialization of cell types

31 Some essential controls on the cell cycle evolved when animals first appeared

32 A-P patterning, Hox complex

33 A-P patterning Hox complex Most signaling pathway and transcription factor families, intron-exon structure, genome organization Early animal genomes are (in some ways) more similar to our genome than are the genomes of flies and nematodes CNIDARIANS PLACOZOAN S SPONGESBILATERIANS Metazoan “toolkit”

34 A-P patterning Hox complex Most signaling pathway and transcription factor families, intron-exon structure, genome organization CNIDARIANS PLACOZOAN S SPONGESBILATERIANS Explanations for differences in complexity microRNAs? cis-regulation? larger families?

35 Differences in the numbers of some types of genes do correlate with complexity

36 A-P patterning Hox complex Most signaling pathway and transcription factor families, intron-exon structure, genome organization CNIDARIANS PLACOZOAN S SPONGESBILATERIANS Cell types patterned in complex ways? microRNAs? cis-regulation? larger families? Explanations for differences in complexity

37 Summary Animals evolved a “toolkit” of genes very early in their evolution Early animal genomes are complex! (as are these animals) Though not all questions are answered by the genomes, they are essential tools for finding the remaining answers

38 Acknowledgements Dan Rokhsar Nik Putnam, Oleg Simakov Jarrod Chapman, Emina Begovic Therese Mitros, Uffe Hellsten Heather Marlow and Mark Martindale (U. Hawaii) Kai Kamm, Michael Eitel, Bernd Schierwater (Hanover) Ana Signorovitch, Maria Moreno, Leo Buss, Stephen Dellaporta (Yale) Degnan group (U. Queensland), Kosik group (UC Santa Barbara) Peter Reddien Jessica Witchley, Kathleen Mazza Members of the Reddien Lab Ulf Jondelius, Swedish Museum of Natural History Wolfgang Sterrer, Bermuda Natural History Museum


Download ppt "Simple Animals, Complex Genomes Comparative genomics of sponges, sea anemones, and multicellular pancakes Mansi Srivastava Rokhsar Lab, Department of Molecular."

Similar presentations


Ads by Google