1. Simple Animals, Complex Genomes
Comparative genomics of sponges, sea anemones, and multicellular pancakes
Mansi Srivastava
Rokhsar Lab, Department of Molecular and Cell Biology, UC Berkeley
Reddien Lab, Whitehead Institute for Biomedical Research
Work on intro, transition to regeneration, timing, look up pathways cell cycle, growth, death

2. Outline Introduction Insights from genomic analyses
3. Linking genomic complexity to biological complexity
1a)origin of interest, 1b)meet the animals

3. Change title to include biological complexity

4. What is the genomic basis for the difference in complexity?
BILATERIANS
PLACOZOANS
SPONGES
CNIDARIANS
The biology of more “complex” animals has been studied and their genomes have been available for a while. This has been helpful in exploring many different questions. The next step is to look at morphologically simpler animals in order to answer different questions such as the origins of multicellularity and the gut and nervous system. One of the first steps in studying these animals is sequencing their genomes. The pedestrian assumption would be that a morpholigically less complex animal would have a less complex genome. I will show you that this is not the case. I am really excited about diving into questions that stem from the friction of having a morphologically simple organism with a complex genome.
Remember to talk about trichoplax not being placed
bilateral symmetry, centralized nervous system
true muscle
true gut
nervous system
tissue grade ?
multicellularity

5. Three species were selected for genome sequencing
SEA ANEMONE
PLACOZOAN
SPONGE
1a)origin of interest, 1b)meet the animals

6. Nematostella vectensis is a sea anemone
Nematostella is a great lab rat
(Finnerty et al. 2004)

7. Trichoplax is a placozoan
(photo credits: Ana Signorovitch, Michael Eitel, Bernd Schierwater)

8. Amphimedon queenslandica is a sponge
Adult
Larvae
(photo credits: Bernie Degnan)

9. These animal genomes have been sequenced
using a Whole Genome Shotgun strategy
ATTTGCATGCGTAATTCAAT
CGTAATTCAATGTGTGATTC
ATTTGCATGCGTAATTCAAT
CGTAATTCAATGTGTGATTC
ATTTGCATGCGTAATTCAATGTGTGATTC

10. These animal genomes have different sizes, but the numbers of genes/proteins are in the same ballpark
Genome
exon
intron
Genes
Proteins
Nematostella
(cnidarian)
Trichoplax
(placozoan)
Amphimedon
(sponge)
Human
C. elegans
(nematode)
Drosophila
(fruit fly)
Genome size (Mb)
450 98
190
3,000 97
120
Gene Models
~18,000
~11,500
~24,000
~20,000
~14,000

11. Not an ancient animal gene
Before comparing their genomes, we need to know how these animals are related to each other and to us * * * * * *
BILATERIANS
BILATERIANS
Change title to include biological complexity
Not an ancient animal gene
Ancient animal gene
Lost in sponges

12. Live birth, hair, warm blood, four chambered heart
Orthologous protein sequences can reveal how organisms are related to each other
RLKMTPIR
PIDWDCMW
MTLPDCMW
RKLPDCMW
fly
fish
mouse
human
Live birth, hair, warm blood, four chambered heart
vertebrae
RLKMTPIR
PIDWDCMW
MTLPDCMW
RKLPDCMW

13. Placozoans represent a sister lineage to cnidarians and bilaterians
Animals

14. Whole-genome data can resolve early animal relationships
BILATERIANS
SPONGES
PLACOZOANS
CNIDARIANS
bilateral symmetry, centralized nervous system
true muscle
true gut
nervous system
tissue grade
multicellularity

15. Previously, some developmental processes were thought to be conserved in the bilaterian ancestor
A-P patterning
Hox complex
Gene structure or genome organization (except for the Hox cluster) were not known to be ancient

16. How do the structures of genes compare between animal genomes?
exon
intron
Genes
Proteins
Change title to include biological complexity

17. Sea anemones, placozoans, and sponges have preserved
many (>80%) ancient introns
(this is not the case for flies and nematodes, which have lost a majority of ancestral metazoan introns)
472 could be traced back to the eukaryotic ancestor; 928 could be traced back to the common ancestor of metazoans
Median intron sizes in Amphimedon are reduced relative to Monosiga and other metazoans: Monosiga has a median intron size of 117 bp, Amphimedon has 81 bp, Trichoplax, Nematostella and human have 105 bp, 377 bp, and 1045 bp, respectively.
Only 12 introns (less than 1%) in Trichoplax are not shared with any of the six other species. For Nematostella this figure is 1.1%.
(in collaboration with Uffe Hellsten)

18. What about how genes are organized relative to each other?
Change title to include biological complexity

19. The positions of orthologous genes can be compared between two species

20. Gene order conservation decreases with evolutionary distance
Synteny “same thread”
genes present on the same chromosome

21. No chromosome scale synteny is observed between vertebrates and flies
Human
Drosophila

22. Nematostella, Trichoplax, and Amphimedon scaffolds show conserved synteny with human chromosome segments
(Nik Putnam)

23. There is considerable scrambling of gene order in these blocks of conserved synteny
(Nik Putnam)

24. What is the significance of this conserved synteny?
Change title to include biological complexity

25. Another way to compare genomes is in terms of gene content…

26. Trichoplax has genes for neurons and epithelial cells

27. Trichoplax has genes for developmental signaling pathways

28. Early animal lineages may lack certain cell types or biological processes, but their genomes encode the proteins required for these in bilaterians
Change title to include biological complexity

29. Many “important” genes are involved in processes essential for animal multicellularity
Six hallmarks of animal multicellularity:
Regulated cell cycle and growth
Programmed cell death
Cell-cell and cell-matrix adhesion
Allorecognition and innate immunity
Specialization of cell types
Developmental signaling

30. Comparing early animal genomes allows us to study the temporal origins of animal biology
Six hallmarks of animal multicellularity:
Regulated cell cycle and growth
Programmed cell death
Cell-cell and cell-matrix adhesion
Developmental signaling
Allorecognition and innate immunity
Specialization of cell types

31. Some essential controls on the cell cycle evolved
when animals first appeared
Change title to include biological complexity

32. A-P patterning, Hox complex

33. Early animal genomes are (in some ways) more similar to our genome than are the genomes of flies and nematodes
SPONGES
PLACOZOANS
CNIDARIANS
BILATERIANS
A-P patterning Hox complex
Given this surprising complexity of the genome going so far back in time,,the question that intrigues me the most is how the genomic complexity related to the morphologies of these animals. For example, now that we have extended the origins of many genes to the common animal ancestor, what can we say about the roles of these genes in these early phyla? If A-P patterning genes are present, can we say that they are being used for axial patterning? Or for something else? How are the same genomic raw materials resulting in drastically different complexities in morphology. There are some obvious explanations – cis-reg, phylum specific genes. Gene family expansions – which I would be happy to talk about later. But, the explanatory power of these hypotheses rests on what the functions of the conserved genes are in these varied, beautiful animals.
Metazoan “toolkit”
Most signaling pathway and transcription factor families, intron-exon structure, genome organization

34. Explanations for differences in complexity
SPONGES
PLACOZOANS
CNIDARIANS
BILATERIANS
microRNAs?
cis-regulation?
larger families?
A-P patterning Hox complex
Given this surprising complexity of the genome going so far back in time,,the question that intrigues me the most is how the genomic complexity related to the morphologies of these animals. For example, now that we have extended the origins of many genes to the common animal ancestor, what can we say about the roles of these genes in these early phyla? If A-P patterning genes are present, can we say that they are being used for axial patterning? Or for something else? How are the same genomic raw materials resulting in drastically different complexities in morphology. There are some obvious explanations – cis-reg, phylum specific genes. Gene family expansions – which I would be happy to talk about later. But, the explanatory power of these hypotheses rests on what the functions of the conserved genes are in these varied, beautiful animals.
Most signaling pathway and transcription factor families, intron-exon structure, genome organization

35. Differences in the numbers of some types of genes do correlate with complexity
Change title to include biological complexity

36. Explanations for differences in complexity
SPONGES
PLACOZOANS
CNIDARIANS
BILATERIANS
microRNAs?
cis-regulation?
larger families?
A-P patterning Hox complex
Given this surprising complexity of the genome going so far back in time,,the question that intrigues me the most is how the genomic complexity related to the morphologies of these animals. For example, now that we have extended the origins of many genes to the common animal ancestor, what can we say about the roles of these genes in these early phyla? If A-P patterning genes are present, can we say that they are being used for axial patterning? Or for something else? How are the same genomic raw materials resulting in drastically different complexities in morphology. There are some obvious explanations – cis-reg, phylum specific genes. Gene family expansions – which I would be happy to talk about later. But, the explanatory power of these hypotheses rests on what the functions of the conserved genes are in these varied, beautiful animals.
Cell types patterned in complex ways?
Most signaling pathway and transcription factor families, intron-exon structure, genome organization

37. Summary
Animals evolved a “toolkit” of genes very early in their evolution
Early animal genomes are complex!
(as are these animals)
Though not all questions are answered by the genomes, they are essential tools for finding the remaining answers
1a)origin of interest, 1b)meet the animals

38. Acknowledgements Dan Rokhsar Nik Putnam, Oleg Simakov
Jarrod Chapman, Emina Begovic
Therese Mitros, Uffe Hellsten
Heather Marlow and Mark Martindale (U. Hawaii)
Kai Kamm, Michael Eitel, Bernd Schierwater (Hanover)
Ana Signorovitch, Maria Moreno, Leo Buss, Stephen Dellaporta (Yale)
Degnan group (U. Queensland), Kosik group (UC Santa Barbara)
Peter Reddien
Jessica Witchley, Kathleen Mazza
Members of the Reddien Lab
Ulf Jondelius, Swedish Museum of Natural History
Wolfgang Sterrer, Bermuda Natural History Museum
Change title to include biological complexity