Presentation is loading. Please wait.

Presentation is loading. Please wait.

DEPARTMENT OF BIOLOGY POST GRADUATE SCHOOL BOGOR AGRICULTURAL UNIVERSITY 2009.

Similar presentations


Presentation on theme: "DEPARTMENT OF BIOLOGY POST GRADUATE SCHOOL BOGOR AGRICULTURAL UNIVERSITY 2009."— Presentation transcript:

1 DEPARTMENT OF BIOLOGY POST GRADUATE SCHOOL BOGOR AGRICULTURAL UNIVERSITY 2009

2 MAJOR MICROBIOLOGY : AN OVERVIEW  Established in 1990 as Subprogram Study in the Study Program of Biology  Composed on 2 division: Microbiology (Bacteriology) Mycology  Staffs: 1 Prof, 10 doctors  Number of Student : ongoing student: 13 master, 8 doctoral incoming student: 16 master, 3 doctoral  Programmes : 1. Master in Microbiology: microbial biodiversity and bioprospecting, and environmental microbiology  Doctor of Philosophy in Microbiology  Supporting unit: IPB Culture Collection (currently developing through I- MHERE project

3 VISION  To be recognized world-wide as the leading centre in tropical microbiological science for agriculture development and for human life quality improvement in 2020.

4 MISSION  To develop human resources with high capacities in tropical microbial knowledge and technologies through undergraduate and postgraduate education.  To expand and transfer microbial knowledge and technologies for continuous improvement of agriculture and human life.  Increase the quality and quantity of research in tropical microbial knowledge and technologies particularly in biodiversity and bio-prospecting.  Increase networking through research and education partnership locally, nationally and globally.

5 CURRICULUM Master of Science Program (39 CSU) General courses English 3 CSU Stastical Analyses 3 CSU Compulsory courses Advanced Microbiology 2 CSU Microbial Physiology 2 CSU Microbial Genetic 2 CSU Microbial Laboratory 2 CSU Microbial Biotechnology 3 CSU Fungal Biotechnology 3 CSU Methodology of Science 2 CSU Colloqium 1 CSU Seminar 1 CSU Research and Thesis 6 CSU Elective courses Bio- prosepecting Industrial Microbiology 3 CSU Molecular Biotechnology 3 CSU Biotechnology of Antimicrobial Susbtance 3 CSU Environmental Microbiology Host-Microbes Interaction 3 CSU Environmental Microbiology 3 CSU Spoilage Fungi and Mycotoxins in foodstuff 3 CSU

6 CURRICULUM Doctor of Philospophy Program (41 CSU) General Course Philosophy of Science 2 CSU Compulsory courses Advanced Microbial Physiology 3 CSU Advanced Fungal Biology 3 CSU Molecular Biology of Prokaryotic Diversity 3 CSU Microbial Genetic Engineering 3 CSU Colloqium 1 CSU Seminar 1 CSU Research and Thesis 12 CSU Elective courses Biology of Pathogenic Bacteria2 CSU Gene Expression and Regulation 3 CSU Biology and Productivity of Actinomycetes 3 CSU Biology of Mycorrhiza3 CSU Biology and Productivity of Macrofungi3 CSU

7 Teaching Staffs and Field Interest 1. Prof. Dr. Antonius Suwanto, MSc., Ph.D (Microbiology and Molecular genetics) 2. Dr. Anja Meryandini, MS (Microbial Physiology and Enzymology) 3. Dr. Aris Tri Wahyudi, MSi (Microbial Biotechnology) 4. Dr. Iman Rusmana, MSi. (Environmental Microbiology) 5. Dr. Nisa Rachmania, MSi. (Microbiology and Microbial Physiology) 6. Dr. dr. Sri Budiarti (Medical Microbiology, Bacterial-Human Cell Interaction) 7. Dr. Yulin Lestari (Microbial Ecophysiology) 8. Dr. Gayuh Rahayu (Mycology and Phytopathology) 9. Dr. Lisdar A Manaf (Mushroom Biology and Fungal Ecophysiology) 10. Dr. Nampiah Sukarno (Mycology and Mycorrhizal Biology) 11. Dr. Okky S. Darmaputra (Post Harvest Mycology)

8 RESEARCH

9 BACTERIOLOGY

10

11 Marine Bioechnology Producing Anti- microbial Compounds Producing Enzyme Inhibitors Student Involved: 4 Students Sponge-Associated Bacteria Targets: 1. Antimicrobial Compounds from sponge-associated Bacteria 2. Molecules/Compounds as Enzyme Inhibitors 3. Molecular Genetic of Antimicrobial Compounds Synthesis Molecular Genetics Aris Tri Wahyudi, PhD

12 Plant Growth Promoting Rhizobacteria (PGPR) Plant Growth Promotion Bioactive Compounds Anti Phytopathogen Student involved: 7 Students (2 PhD ; 2 S-2, 3 S-1) 1.Formulation of PGPR as plant growth and Biocontrol 2.Molecular Genetic of Bioactive Compound Synthesis 3.Bioactive Compounds/Antibiotic from PGPR Biocontrol of Phytopathogen Formulation and Inoculant Prod. -Pseudomonas sp -Bacillus sp Aris Tri Wahyudi, PhD

13 Dr. Anja Meryandini Research Interest: Microbial enzymes - Bacterial protease - Bacterial mannanase - Bacterial xylanase for animal feed processing Clostridium bifermentans producing protease enzyme Streptomyces sp. producing xylanase enzyme P-16 SKK1-8

14 Dr. Nisa Rachmania Mubarik, MSi Head of Microbiology Division, Department of Biology, Faculty of Mathematics and Natural Sciences, Bogor Agricultural University Research Interest: Symbiotic Effectiveness of Inoculant Acid-Alumunium Tolerant Bradyrhizobium japonicum Strains with Soybean Cultivar Slamet in Acid Soils Symbiotic Effectiveness of Inoculant Acid-Alumunium Tolerant Bradyrhizobium japonicum Strains with Soybean Cultivar Slamet in Acid Soils (3 master students, ) Isolations,Characterizations and Applications Microbial Enzymes (Protease, Amylase, Chitinase) Isolations, Characterizations and Applications Microbial Enzymes (Protease, Amylase, Chitinase) (7 undergraduate student, 1 master students, ) Inoculant B. japonicum on peat carrier. 0.5 mm Chitin hydrolization at 12 hours by cell cultures and chitinase of bacterial isolates I.5 and I.21 tested to Bemisia tabaci. Control (a), cell cultures treatment (b- d), enzyme treatment (e-g).

15 Dr. Iman Rusmana  Environmental Microbiologist RESEARCH INTEREST: Current Research Topics: Methanotrophic bacteria as biofertilizers and methane emission reducers in rice fields N 2 O reducing bacteria to reduce N2O emission from agriculture system Nitrate reducing bacteria and Bacillus spp. as bioactive of biofilter in close system of larval rearing and nursery of aquacultures Nitrate reducing and nitrifying bacteria as bioconditioner controlling nitrite and ammonia in shrimp ponds Nitrogen cycling and N 2 O emission in tropical estuaries and agricultural system Student involved (9 master, 1 PhD)

16 Amplification of mmoX gene Amplification of pmoA gene Size of DNA fragments Molecular characterization of methane monooxygenase genes Forward sequence of BGM9 mmoX gene: ATAANCGCAGCGTGTTNCAGGTCCGCGAGATCGCCGACCAGTCCGCCGCCGNCAGCNAGCAGACCGCCAGCTCCAGCA ACGAACTGGCGCACCTGGGCAACGAGCTGCAACTGCAGGTGGGACGTTTCCGCCTGTGACACGCCNGTCGGTCGGTAC GCCCGCTCCGGCCGATAACGGCAGGACAGTTGTCATGCGCATGGCGTAGGATCGGACACTCGCCATGAAGGGAGAGTG ACCATGCGCCCGCTGACCATCGATATCGACGAACTGGACCTTCGCGCTTGATACCCAGGGTATCGATCACTACCTCGACC TGTTCAGTGGCCAGGTGCTGCTGATACCGGAGGACGACCCCGACCCGGAGCTCGCCGAACTGCTGCACCGCGAGCCGG AGCGCTACGAGTG Reverse sequence of BGM9 mmoX gene: GGTATCANCAGCACCATGGCCACTGAACAGGTCGAGGTAGTGATCGATACCCTGGGTATCAAGCGCGAAGGCCAGTTC GTCGATATCGATGGTCAGCGGGCGCATGGTCACTCTCCCTTCATGGCGAGTGTCCGATCCTACGCCATGCGCATGACAA CTGTCCTGCCGTTATCGGCCGGAGCGGGCGTACCGACCGACAGGCGCGTCACAGGCGGAAACGTCCCACCTGCAGTTG CAGCTCGTTGCCCAGGCGCGCCAGTTCGGTGCTGGAGCTGGCGGTCTGCTCGCTGGCGGCGGCGGACTGGTCGGCGAT CTCGCGGACCTGCACCACGCTGCGGTTGATCTCCTCGGCAACGCTGCTCTGCTCCTCGGCGGCCGANGCGATCTGCAGG TTCATGCCCTTCCACAGCGGATATAATA Sampling for measurement and molecular analysis of nitrate reducing bacteria in sediment of tropical estuaries Bacteriocins purification and its antimicrobial activity from Bacillus spp. isolated from shrimp ponds FROM MOLECULAR TO ECOLOGY

17 Dr. dr. Sri Budiarti Research Interest: Medicinal Microbiology  Enteropathogenic Eschericia coli: - mode of infection - Extracellular protease activity - Monoclonal antibody antiprotease activity -Diagnostic kit design  Dengue and environmental health  Screening of Antimicrobial substance from bacteria and fungi

18 INDONESIAN ACTINOMYCETES AS SOURCE OF BIOACTIVE COMPOUNDS USED FOR SOLVING AGRICULTURE, ENVIRONMENT AND HEALTH PROBLEMS 1.Collection of Actinomycetes isolates from unique tropical environment, and endophyte actinomycetes 2.In vitro and in vivo assay for: antimicrobes, enzyme inhibitor (e.g. a-glucosidase, b-lactamase), degrading enzymes (lipase, cellulose and lignolitic enzymes) 3.Target organisms: agriculture & horticulture plants, plantation, poultry, and human ) 4.Student involve: undergraduates (2),graduates ( 4 Master students), and 3 PhD students) Dr.Ir. Yulin Lestari

19 MYCOLOGY

20 Diversity of Indonesian Filamentous Fungi (205 genera) Agaricales Mucorales Eurotiales Hypocreales Incertae sedis Polyporales Zygomycota Basidiomycota Ascomycota

21 RESEARCH TITLE (Year 2009) : Population of Aspergillus flavus and Aflatoxin B 1 Contents from Processed Peanut Products in Municipality of Bogor. ACTIVITIES : Survey of processed peanut product consumptions Sampling method of processed peanut products Determination of A. flavus population and aflatoxin B 1 contents EXPECTED OUTPUT :informations on A. flavus population and the levels of aflatoxin B 1 in processed peanut products at retail levels Dr. Okky Setyawati Darmaputra FUNGI ON FOODSTUFF AND THEIR MYCOTOXIN

22 Research Interest:  Biology and Application of Phosphate Solubilizing Fungi  Biology and Application Mycorrhizal Fungi Dr. Ir. Nampiah Sukarno Development of Aspergillus carrying GFP gene for studying the ecological and colonization process T. caccao Curcuma sp. P. falcataria a b. c. a b. c.. J. curcas a b. c.. Post tin mining area P. macrocarpa Agriculture area Green house a. Control, b. A. niger, c. AMF

23 Edible Ectomycorrhiza

24 Dr. Ir. Gayuh Rahayu Research Interest:  Artificial Production of agarwood (Jin-koh) in planta and in vitro culture: - Inoculant Production - Mechanisms of terpenoid production - Inoculation Techniques  Manipulation of Soil Fungi for Forest Tree Growth and Health -Fungal decomposer of Shorea and Dryobalanops litter and plant growth regulator producers (student involved: 1 master, 1 undergraduates) Student involved ( 3 master students) Thermophilic Fungi compost ZPT bioassay  Amylolytic Fungi and its fermentation capacity for ethanol production - Screening of potential mold and yeast

25 Dr.Ir. Lisdar A.M. Sudirman Research Interest: -Mushroom Biology and Biotechnology - Mushroom Antimicrobial activity


Download ppt "DEPARTMENT OF BIOLOGY POST GRADUATE SCHOOL BOGOR AGRICULTURAL UNIVERSITY 2009."

Similar presentations


Ads by Google