Presentation is loading. Please wait.

Presentation is loading. Please wait.

C4 long gene (20.4kb) C4 short gene (14.1kb) HERV-K(C4) Exon26, amino acids 1101-1106 C4B gene C4A gene 110111021103110411051106 PCPVLD GGGGGGACAACAGGTCACAATCTGCTG.

Similar presentations


Presentation on theme: "C4 long gene (20.4kb) C4 short gene (14.1kb) HERV-K(C4) Exon26, amino acids 1101-1106 C4B gene C4A gene 110111021103110411051106 PCPVLD GGGGGGACAACAGGTCACAATCTGCTG."— Presentation transcript:

1 C4 long gene (20.4kb) C4 short gene (14.1kb) HERV-K(C4) Exon26, amino acids C4B gene C4A gene PCPVLD GGGGGGACAACAGGTCACAATCTGCTG LSPVIH GAGGAGAGAAGAGGTCACTATGTAGTA STK19C4CYP21TNXB SNP rs [G/T] STK19C4 CYP21 TNXB TNXA STK19P STK19C4 CYP21 TNXA STK19P C4CYP21TNXB STK19P TNXA STK19C4 CYP21 TNXA STK19P C4CYP21 STK19P TNXA C4CYP21TNXB STK19P TNXA Supplementary Figure 1 a b Supplementary Figure 1 a The pattern of C4 CNV and the position of SNP rs were shown. This CNV region is reported to have variations of one, two, three or four repeats. Telomeric end is STK19 gene and centromeric end is TNXB gene. Within repeat sequence, C4 and CYP21 are multiplicated as complete genes, whereas STK19 and TNX were truncated to become pseudogenes, STK19P and TNXA, respectively. SNP rs is located at 5’-UTR of TNXB gene and is not included in the repeat sequence. b There are four major variants of C4 genes. Left figure shows that C4 long gene has insertion sequence named HERV-K(C4) in intron 9, whereas C4 short gene does not. C4A and C4B variants differ by only 4 amino acids at position , as shown in right figure.

2 Supplementary Figure 2 RP1-C4L RP1-C4S RP2-C4L RP2-C4S TNXB TNXA 2:22:32:12:2 2:12:2 2: 0: 0: 2 2: 0: 3: 02: 0: 1: 02: 0: 2: 02: 0: 0: 22: 0: 1: 1 2: 0: 0: 1 2: 0: 1: RP1-C4L RP1-C4S RP2-C4L RP2-C4S b c y = x R 2 = log ng of Genomic DNA CTCT R 2 = Gene copy number (Southern) 2 - Ct (qPCR) a TNXB: TNXA

3 Supplementary table 1. Characteristics of cohorts a Age of onset for SLE patients, and age at drawing DNA samples for control patients. nFemaleAge a Case %31.9 +/ Case %27.3 +/ Case %31.6 +/ Control %59.2+/-14.2 Control %51.3+/-14.6 Control %39.0+/-13.5 Supplementary table 2. Probes and primers for qPCR Target geneForward primerReverse primerTaqMan probe C4A 5’-GCA GGA GAC ATC TAA CTG GCT TCT-3’ 5’-CCG CAC CTG CAT GCT CCT-3’ 5’-FAM-ACCCCTGTCCAGTGTTAG-MGB-3’ C4B5’-FAM-ACCTCTCTCCAGTGATAC-MGB-3’ C4S5’-TTC CTT CAC TCC TCC AGT GGA-3’5’-AGT GGT TCC CTC CCA CAA GA-3’5’-FAM-ACAGACAGGAATAC-MGB-3’

4 Case Genotype Control Genotype Frequency of A allele Odds ratio a (95%CI) p value a nAAAGGGnAAAGGGCaseControl 1 st stage ( ) nd stage ( ) Total ( )5.18×10 -6 Supplementary table 3. Association of SNP rs from genome-wide study a Odds ratio of allele count model (A or G). b Fisher’s exact test of allele count model. Supplementary table 4. CNV analysis on female subgroup A B C4B012345Mean+/- SDP value a Control /-0.47 Case1, Case / * C Mean+/- SDP value a Control /-0.70 Case1, Case / * a Results of Wilcoxon rank sum test comparing the copy numbers of Case1 and Case 2 with Control 2. The significant level alpha=0.025 for all the tests. * indicated p values below significant level.

5 Case Genotype Control Genotype Frequency of G allele Odds ratio a (95%CI) p value b nGGGTTTnGGGTTTCaseControl HLA-DRB1*1501(+) c ( )0.092 HLA-DRB1*1501(-) d ( )7.30x10 -5 Supplementary Table 5. Stratified analysis of rs with HLA-DRB1*1501 allele. a Odds ratio of recessive effect (GG or GT+TT). b Fisher’s exact test of recessive effect model. c Those who have at lease one HLA-DRB1*1501 allele. d Those who have no HLA-DRB1*1501 allele at either chromosome.


Download ppt "C4 long gene (20.4kb) C4 short gene (14.1kb) HERV-K(C4) Exon26, amino acids 1101-1106 C4B gene C4A gene 110111021103110411051106 PCPVLD GGGGGGACAACAGGTCACAATCTGCTG."

Similar presentations


Ads by Google