1. Mahender Singh 1*, W S Lakra 2, Y Ph Kartavtsev 3, A K Singh 1, S N Bahuguna 4 1 National Bureau of Fish Genetic Resources, Lucknow, India; 2 Central Institute of Fisheries Education, Mumbai, India 3 A.V. Zhirmunsky Institute of Marine Biology, Vladivostok, Russia 4 Hemwati Nandan Bahuguna Garhwal University, Srinagar, Uttrakhand, India; D NA B arcoding and M olecular P hylogeny of G lyptothorax S pecies (Siluriformes, sisoridae) ISO: 9001: 2008 http://www.nbfgr.res.in/

2. T AXONOMY I N A CTION — the leader in establishing and operating partnerships for taxonomy in developing countries | www.bionet-intl.org | bionet@bionet-intl.orgwww.bionet-intl.orgbionet@bionet-intl.org http://www.nbfgr.res.in/ DNA Barcoding: Glyptothorax Species Glyptothorax G. garhwali G. dakpathari G. brevipinnis G. ngapang Siluriformes, sisoridae  Attached to rocks, boulders, stones at the bottom of the water bodies where they live by means of a thoracic adhesive apparatus : a sort of sucking disk as an adaptive structure.  several new species have been reported from India in the past few years (Vishwanath & Linthiongambi 2006, 2007).  The debate over the criteria to recognize the species and subspecies boundaries has received considerable attention in recent years

3. T AXONOMY I N A CTION — the leader in establishing and operating partnerships for taxonomy in developing countries | www.bionet-intl.org | bionet@bionet-intl.orgwww.bionet-intl.orgbionet@bionet-intl.org © Author of image | affiliation Impact of geo-climatic factors: affect of boulders and water current on dimensions of adhesive apparatus, size of cavity, which are the key identification characters ?  (Siluriformes, sisoridae) : with 89 species world over and 29 species from India alone is highly difficult to resolve at species level http://www.nbfgr.res.in/ DNA Barcoding: Glyptothorax Species Adhesive Apparatus of seven investigated Glyptothorax species. A- G. garhwali (G3), B- G. garhwali (GG), C- G. garhwali (G4), D- G. dakpathri, E- G. brevipinnis, F- G. ngapang, G- G. granulus, H- G. ventrolineatus, I- G. davissinghi  Identification in Glyptothorax has also been a matter of debate  Identification generally based on dichotomous keys : ratios of various lengths

4. T AXONOMY I N A CTION — the leader in establishing and operating partnerships for taxonomy in developing countries | www.bionet-intl.org | bionet@bionet-intl.orgwww.bionet-intl.orgbionet@bionet-intl.org © Arthur D. Chapman | Australian Biodiversity Information Services http://www.nbfgr.res.in/ DNA Barcoding: Glyptothorax Species DNA barcoding: for taxon recognition and classification  Taxon recognition based on small sequence fragment (655 base pairs) near the 5’end of mitochondrial gene cytochrome c oxidase I (COI) with universal primers is proved to be effective (Hebert et al., 2003).  This barcode is also suitable marker for discriminating between closely related species of marine and freshwater fishes DNA barcoding is also species substitution food productsregulated speciescontrol of invasive species, pest management, water quality control etc. DNA barcoding is also being used for detection of species substitution in processed food products, illegal products from regulated species control of invasive species, pest management, water quality control etc.

5. T AXONOMY I N A CTION — the leader in establishing and operating partnerships for taxonomy in developing countries | www.bionet-intl.org | bionet@bionet-intl.orgwww.bionet-intl.orgbionet@bionet-intl.org © Antonio G. Valdecasas |MNCN, CSIC | Spain http://www.nbfgr.res.in/ DNA Barcoding: Glyptothorax Species Glyptothorax Species P resent Study: Resolving ambiguities in Glyptothorax Species (i) Use of well recognized DNA barcoding methodology vis-à- vis morphological character- based criteria to fix the molecular signature for species ii) To determine if COI based barcoding is suitable for species identification as well as molecular phylogeny in Glyptothorax catfishes with overlapping range of morphometric characters and iii) To prove whether Glyptothorax genus of catfish is monophyletic based on currently analyzed COI dataset as well as concatamer with earlier dataset of Cyt b. Voucher specimens of Glyptothorax

6. T AXONOMY I N A CTION — the leader in establishing and operating partnerships for taxonomy in developing countries | www.bionet-intl.org | bionet@bionet-intl.orgwww.bionet-intl.orgbionet@bionet-intl.org Glyptothorax Sampling Sites [ ] in India  Khanda Gad Near Srinagar in Garhwal, Uttarakhand  Maldevta, Dehradun, Uttarakhand  Yamuna Barrage, Dakpathar, Dehradun, Uttarakhand  Tatapani, Shimla, Himachal Pradesh  Downstream of Poringalkuthu Dam, Trishur, Kerala  Serou, Manipur http://www.nbfgr.res.in/ DNA Barcoding: Glyptothorax Species

7. T AXONOMY I N A CTION — the leader in establishing and operating partnerships for taxonomy in developing countries | www.bionet-intl.org | bionet@bionet-intl.orgwww.bionet-intl.orgbionet@bionet-intl.org Species NameLat/ Long/ Alt Sample Size Accession Numbers Haplotype Diversity (1) G. garhwali 30.13/ 078.47/ 178031 EU637835-EU637839, EU637785,EU637786, EU637788, EU637791-802, EU637804-812 0.2968 (2) G. dakpathri 31.14/ 077.05/ 208713EU637830-34, EU637777-840.9103 (3) G. brevipinnis 30.20/ 078.07/ 238223 FJ423570-75, FJ208927-33,EU637840- 44, EU637813-29, 0.5261 - “ - 30.30/ 077.47/ 14767 - “ - 30.12/ 078.44/ 20836 (4) G. ngapang 24.16/ 093.52/ 252115 FJ347806, FJ347807, FJ347815-17, FJ347820, FJ347827,FJ347830, FJ347831, FJ347834, FJ347835, FJ347837-41 0.7917 (5) G. granulus 24.16/ 093.52/ 252114FJ347842-47, FJ347857-650.3956 (6) G. ventrolineatus 24.16/ 093.52/ 25219FJ347797-8050.8056 (7) G. davissinghi 10.16/076.26/2218FJ347789-960.7500 Total126 http://www.nbfgr.res.in/ DNA Barcoding: Glyptothorax Species Samples were collected from different regions across India. Samples were collected from different regions across India. Muscle and fin tissues were preserved in 95 % v/v ethanol.

8. T AXONOMY I N A CTION — the leader in establishing and operating partnerships for taxonomy in developing countries | www.bionet-intl.org | bionet@bionet-intl.orgwww.bionet-intl.orgbionet@bionet-intl.org http://www.nbfgr.res.in/ DNA Barcoding: Glyptothorax Species  Approximately 50 mg of caudal or anal fin or muscular tissue was used for DNA isolation following standard phenol/chloroform method (Sambrook et al., 1989) with partial modifications. universal primers Fish  The partial COI gene was amplified using the universal primers Fish F1 5’TCAACCAACCACAAAGACATTGGCAC3 & FishR1-5’TAGACTTCTGGGTGGCCAAA GAATCA3 (Ward et al. 2005). Sanger et al., 1977using an automated ABI 3730 sequencer  DNA sequencing was performed following the dideoxynucleotide chain termination method ( Sanger et al., 1977 ), using an automated ABI 3730 sequencer  The COI sequences  The COI sequences were aligned and primer sequences were trimmed, to get uniform length sequences of 655 base. CLUSTALW (Thompson et al. 1994),  Sequences were aligned using CLUSTALW (Thompson et al. 1994), refereed against electropherogram and submitted to GenBank. The phylogenetic trees were visualized and edited where necessary with FigTree (http://tree.bio.ed.ac.uk/software/figtree/) and Dendroscope (http://ab.inf.uni- tuebingen.de/software/dendroscope/) (Huson et al., 2007; 2010) softwarehttp://tree.bio.ed.ac.uk/software/figtree/

9. T AXONOMY I N A CTION — the leader in establishing and operating partnerships for taxonomy in developing countries | www.bionet-intl.org | bionet@bionet-intl.orgwww.bionet-intl.orgbionet@bionet-intl.org http://www.nbfgr.res.in/ Sr. No.SpeciesVoucher Code Accession No. of COI Accession No. of Cyt b G. burmanicusKIZ:0329HQ593567HQ593591 G. deqinensisKIZ:200515001HQ593564HQ593590 G. f. fokiensis Both COI & Cyt b sequences taken from same mitochondrial genome NC018769 G. hainanensisKIZ:WWY20080124HQ593584HQ593597 G. honghensisKIZ:2007004027HQ593583HQ593596 G. interspinalusKIZ:200101023HQ593563HQ593589 G. longicaudaKIZ:05488HQ593578HQ593593 G. longinemaKIZ:05219HQ593573HQ322509 G. macromaculatusKIZ:20040929016HQ593568HQ593592 G. minimaculatusKIZ 05698HQ593579HQ322547 G. obliquimaculatusKIZ:20050415021HQ593576HQ322553 G. quadriocellatusKIZ:200101022HQ593562HQ593588 G. trilineatusKIZ:20050417014HQ593572HQ322512 G. zanaensisKIZ1818HQ593574HQ322507 Silurus lanzhouensis Both COI & Cyt b sequences taken from same mitochondrial genome NC015650 Silurus asotus Both COI & Cyt b sequences taken from same mitochondrial genome AP012022 Bagarius yarrelliINHS:93673EU490855EU490904 For phylogenetic tree making, COI and Cyt b sequences of 14 Glyptothorax species submitted in NCBI by other researchers were also downloaded to present a comprehensive overview and elucidate phylogenetic relationship

10. T AXONOMY I N A CTION — the leader in establishing and operating partnerships for taxonomy in developing countries | www.bionet-intl.org | bionet@bionet-intl.orgwww.bionet-intl.orgbionet@bionet-intl.org http://www.nbfgr.res.in/ DNA Barcoding: Glyptothorax Species Result highlights: Analysis of COI : Out of 655 positions,  514 were conserved (82.6%)  114 (17.4%) were variable  10 were singleton (1.5%)  104 (15.9%) were parsimoniously informative (at least two of nucleotides occurring with a minimum frequency of two). As the adhesive apparatus is key character, it was photographed in mature specimens of all seven species. By adhesive apparatus and morphological data, two populations of G. garhwali considered as different species G. garhwali

11. T AXONOMY I N A CTION — the leader in establishing and operating partnerships for taxonomy in developing countries | www.bionet-intl.org | bionet@bionet-intl.orgwww.bionet-intl.orgbionet@bionet-intl.org http://www.nbfgr.res.in/ DNA Barcoding: Glyptothorax Species K2P model in MEGA) Number of base substitutions per site (K2P model in MEGA) were calculated and it is found to be highest in G. dakpathri and G. davissinghi (K2P = 0.0040 in both) whereas the least divergence is shown within G. garhwali (K2P = 0.0005)

12. T AXONOMY I N A CTION — the leader in establishing and operating partnerships for taxonomy in developing countries | www.bionet-intl.org | bionet@bionet-intl.orgwww.bionet-intl.orgbionet@bionet-intl.org http://www.nbfgr.res.in/ DNA Barcoding: Glyptothorax Species Estimates of evolutionary divergence in K2P over sequence pairs within and between 7 species of genus Glyptothorax G. garhwali G. dakpathri G. brevipin nis G. ngapan g G. granulus G. ventroline atus G. davissin ghi G. garhwali 0.0005 G. dakpathri 0.08510.0040 G. brevipinnis 0.08180.03450.0014 G. ngapang 0.09910.07350.06770.0024 G. granulus 0.09300.07740.07230.06280.0009 G. ventrolineatus 0.08060.05050.04020.07120.06890.0022 G. davissinghi 0.07610.04090.03030.04950.06110.04970.0040

13. Average genetic divergence: over sequence pairs between species http://www.nbfgr.res.in/ DNA Barcoding: Glyptothorax Species  The calculation of average genetic divergence over sequence pairs between groups was found to be highest between G. ngapang and G. garhwali (K2P = 0.0991)  while the least divergence is shown between G. davissi nghi and G. brevippinisi (K2P = 0.0303) species

14. The phylogenetic and evolutionary history :  59 sequences for our and GenBank representatives of Glyptothorax catfish jointly with 3 outgroup specimens Bayesian (BA) algorithm COI gene phylogram  G. dakpathari, G. davissinghi, G. brevipinnis and G. ventrolineatus G. Garhwali G. Ngapang G. Granulus with 14 GenBank species-sequences with well supported nodes, as proved by two genes data  Slight difference in topology may be due to mutation rate variation among genes and lineages

15. http://www.nbfgr.res.in/ Bayesian (BA) algorithm Combined phylogram of COI and Cyt-b genes  59 sequences for our and GenBank representatives of Glyptothorax catfishes jointly with 3 outgroup specimens  In the nodes the support levels (%) are: BA, ML, MP, and NJ.  Abbreviation 100 x 4 denotes: 100,100,100,100 and 100 x 3 denotes: 100,100,100 Results revealed that COI, as well as Cyt-b (Singh et al., 2012 and this study), are the effective markers for identifications of seven species of Glyptothorax from India

16. The lowest stable ancestor (LSA) consensus tree : COI and Cyt-b Tanglegram built for COI vs. Cyt-b genes as previously for 59 sequences of our and GenBank representatives jointly with 3 outgroup specimens in two approaches depicted at A and B A B  At A the consensus tree made by COI gene trees is represented  At B the consensus tree built by BA algorithm from Cyt-b  Judging on both trees we may conclude that some intragenus lineages as was firstly noted on main COI data and combined two genes data are retained with this more sophisticated approach

17.  These seven species of Sisoridae from the Indian rivers were found genetically distinct from each other.  The adhesive apparatus, considered as the key character for species identification, is not supported by barcode data as G. garhwali has two types of adhesive apparatus  Pairwise comparisons, sequence alignment, intra-specific and inter-specific sequence divergence the pattern of nucleotide substitution found in COI gene of Glyptothorax species, is quite expected for a functionally conserved protein coding region, which has evolved over recent evolutionary time.  Glyptothorax exhibited more nucleotide change at third codon position, with most mutations being synonymous. We also observed anti G bias in this position in the seven species, and the G is mostly substituted with A (both purines with double ring nitrogenous base). Findings : http://www.nbfgr.res.in/ DNA Barcoding: Glyptothorax Species

18.  Estimate of genetic divergence with COI gene was sufficient enough to discriminate individuals of different Glyptothorx species within Sisoridae.  In all seven species, levels of intra-specific variation (K2P sequence divergence) were varied from G. garhwali (0.05%), G. dakpathri (0.40%), G. ngapang (0.24%), G. davissinghi (0.40% ), G. brevipinnis (0.14%), G. granulus (0.09%), G. ventrolineatus (0.22%).  High inter-specific K2P sequence divergence is estimated between G. brevipinnis & G. garhwali (0.129) despite small geographical distance between them and low inter-specific K2P sequence divergence is estimated between G. davissinghi and G. dakpathri (0.002) despite a distance of over 2000 km. Findings : http://www.nbfgr.res.in/ DNA Barcoding: Glyptothorax Species

19. A uthors are thankful to Prof. W. Vishwanath for helping in identification of Glyptothorax species from North East India, National Bureau of Fish Genetic Resources of India for supporting this work. http://www.nbfgr.res.in/ DNA Barcoding: Glyptothorax Species

20. THANK YOU!