Presentation is loading. Please wait.

Presentation is loading. Please wait.

Hutchinson Gilford Progeria Syndrome and Lentivector Group members: Alessandro Angerilli Angela Di Bello Elena Grossi Marta Marzullo Corso di Terapia Genica.

Similar presentations


Presentation on theme: "Hutchinson Gilford Progeria Syndrome and Lentivector Group members: Alessandro Angerilli Angela Di Bello Elena Grossi Marta Marzullo Corso di Terapia Genica."— Presentation transcript:

1 Hutchinson Gilford Progeria Syndrome and Lentivector Group members: Alessandro Angerilli Angela Di Bello Elena Grossi Marta Marzullo Corso di Terapia Genica anno

2 Hutchinson-Gilford disease: Clinical Features Premature development of “segmental” features recalling aging Severe growth retardation Skeletal alteration Amyotrophy, lipodystrophy and skin atrophy Alopecia Extremely severe atherosclerosis The mean age at diagnosis is 2.9 years, while death occurs at a mean age of 13.5 years

3 Molecular characterization In 2003 the disease's genetic basis was identified: HGPS is caused by point mutations that increase utilization of an alternative splice donor site in exon 11 of LMNA (the gene encoding lamin C and prelamin A) NORMAL SEQUENCE C1824T G G T G G G C G G T G G G T Chromosome 1 (1p22)

4 Prelamin A vs Progerin processing HA- lamin A HA- progerin anti-HA

5 Gene therapy approaches Morpholino oligonucleotides FTI GFPex9ex10ex11ex12 wt GFPex9ex10ex11ex12 mut GGC>GGT Clinical Trial in progress ( )

6 Avoid the production of progerin caused by aberrant splicing Recovery of Lamin A isoform Rescue of the wild type phenotype Goals: New gene therapy approach based on TALENs (Transcriptional Activator Like Effectors Nucleases) focused on the classical mutation occurring in HGPS: C1824T

7 Naturally occurring TALE: Recognition code: [one di-residue – one nt] Engineered TALEN:

8 Application of TALEN's technology to HPGS disease: 1) Customization of TALENs to bind sequences flanking the mutated region 1) TALENs-mediated deletion of a specific three-nucleotide codon containing the mutation AACACCTGGGGCTGCGGGAACCACCCAGCTCTCATCAACAACACCT TTGTGGACCCCGACGCCCTTGGTGGGTCGAGAGTAGTTGTTGTGGA CAREFUL TO THE FRAMESHIFT! exon 11 - C1824T The deleted region is part of C-term tail = not essential to protein function! (SWISS PROT)

9 Lentiviral expression vector HTNV Lentiviral Packaging plasmids Ψ 3 rd Generation Lentivectors:

10 hESC and iPSC transduction transduced cells Neo Only cells with transgene Tet-On Only GFP-positive - 1 st A control-group trunsduced with an empty lentiviral vector -2 nd Test the presence of TALENs by Western Blot technique. -3 rd Test the removal of the trinucleotide sequence by real time PCR -4 th Verify if differentiated cells express the Lamin A isoform by Western Blot Check- points: In vitro experiments:

11 Choose an efficient animal model Vector injection 8-month mice: LmnA G608G transgenic mice (atherosclerosis mice) Local carotid arteries injection through “Remedy catheter” and diffused injection through tail vain 4 groups of 5 mice for each mode of injection: 5 individuals LmnA G608G trunsduced with TALEN-HNTV LVs ( 2·10 7 TU/mouse) 5 individuals WT trunsduced with TALEN-HNTV LVs ( 2·10 7 TU/mouse) 5 individuals LmnA G608G trunsduced with Adenoviral vectors (1– pfu) 5 individuals WT trunsduced with Adenoviral vectors (1– pfu) An other control? The same treatment in APOE mice In vivo experiments:

12 Five weeks after injection GFP expression Western blot ELISA - MOLECULAR ANALYSIS To test and quantify progerin expression level To test vector expression and tropism - MORPHOLOGICAL ANALYSIS Histological analysis of aortic section and heart Observation of nuclear architecture HNTV-LV I. α-actin RFP-VECTOR merge AORTIC SECTION AdV Zhong Qian et al PATOLOGICAL ANALYSIS In vivo experiments:

13 Cloning kit ̴̴̴ 490€ (each clone) Lentiviral vector ̴̴̴ 416€ TALEN ̴̴̴ 5000€ iPS AND hESC ̴̴̴ 3000 € C57BL/6J mice(WT) ̴̴ 50 € Transgenic mouse ̴̴̴ 200€ Molecular analysis (antibodies, reagent prc, western blot...) ̴̴̴ 3000€ ELISA kits ̴̴̴ 4000€ Immuno-histochemical analysis ̴̴̴ € General patological analysis ̴̴̴ 200€ Material and costs:

14 References: “A-type lamins and Hutchinson-Gilford progeria syndrome: pathogenesis and therapy”. Gonzalez et al., Frontiers in Bioscience S3, , June 1, 2011 “Molecular bases of progeroid syndromes”. Navarro et al., Human Molecular Genetics, 2006, Vol. 15, Review Issue No. 2 R151–R161 “HGPS and related premature aging disorders: From genomic identification to the first therapeutic approaches”, Pereira et al., Mechanisms of Ageing and Development 129 (2008) 449–459 “Reversal of the cellular phenotype in the premature aging disease Hutchinson-Gilford Progeria Syndrome”, Scaffidi and Misteli, Nat Med April; 11(4): 440–445. “Efficient design and assembly of custom TALEN and other TAL effector-based constructs for DNA targeting”; Cermak et al. Nucleic Acids Research, 2011, Vol. 39, No. 12

15 References: “A Human iPSC Model of Hutchinson Gilford Progeria Reveals Vascular Smooth Muscle and Mesenchymal Stem Cell Defects”; Zhang et al.; Cell Stem Cell Jan 7;8(1): Epub 2010 Dec 23. “Generic engineering of human pluripotent cells using TALE nucleases”; Hockemeyer D. et al.; Nat Biotechnol Jul 7;29(8): “Targeting vascular injury using Hantavirus-pseudotyped lentiviral vectors”.Qian Z et al.;Mol Ther Apr;13(4): Epub 2006 Jan 23 “Progressive vascular smooth muscle cell defects in a mouse model of Hutchinson-Gilford progeria syndrome”; Varga et al.; Proc Natl Acad Sci U S A Feb 28;103(9): “Lamin A/C, laminopathies and premature ageing”; Liu and Zhou; Histol Histopathol (2008) 23:


Download ppt "Hutchinson Gilford Progeria Syndrome and Lentivector Group members: Alessandro Angerilli Angela Di Bello Elena Grossi Marta Marzullo Corso di Terapia Genica."

Similar presentations


Ads by Google