Presentation is loading. Please wait.

Presentation is loading. Please wait.

Breeding and Genetics of Soybean Mosaic Virus Resistance in Soybean Ainong Shi Syngenta Seeds Slater, IA USA Pengyin Chen University of Arkansas Fayetteville,

Similar presentations


Presentation on theme: "Breeding and Genetics of Soybean Mosaic Virus Resistance in Soybean Ainong Shi Syngenta Seeds Slater, IA USA Pengyin Chen University of Arkansas Fayetteville,"— Presentation transcript:

1 Breeding and Genetics of Soybean Mosaic Virus Resistance in Soybean Ainong Shi Syngenta Seeds Slater, IA USA Pengyin Chen University of Arkansas Fayetteville, AR USA

2 Soybean Mosaic Virus (SMV) Most destructive viral disease in soybean Symptoms: Resistant (R, symptomless), necrotic (N, necrotic lesions, or stem-tip necrosis), and susceptible (S, mosaic) Seven strains G1 to G7 identified in U.S.

3 R N S R R R PI96983 (Rsv1)L29 (Rsv3)V (Rsv4) G1G7 G1G7G1 Genetic resistance is the primary method of controlling this disease Three loci, Rsv1, Rsv3, and Rsv4 have been identified and mapped on the molecular linkage group (MLG) F, B2, and D1b, respectively Nine alleles (Rsv1, Rsv1-t, Rsv1-y, Rsv1-m, Rsv1-k, Rsv1-s, Rsv1-r, Rsv1-n, and Rsv1-h) at Rsv1 locus have been reported

4 I.Confirm 2 Genes of Resistance to SMV in J05 Soybean Using SSR Markers II.A PCR-based Marker for the Rsv1 Locus Conferring Resistance to SMV III.Gene Pyramiding for SMV Resistance Using Molecular Markers IV.SNP Markers for SMV Resistance Topic

5 J05, a Chinese soybean cultivar Resistant to all seven SMV strains Containing Rsv1 and Rsv3 ( Zheng et al J. Hered. 97(5): ) I. Confirm 2 Genes of Resistance to SMV in J05 Soybean Using SSR Markers * Ainong Shi, Pengyin Chen, Dexiao Li, Cuiming Zheng, Anfu Hou, and Bo Zhang Genetic confirmation of two independent genes for resistance to soybean mosaic virus in J05 Soybean using SSR markers. J. Heredity 99(6):598–603

6 Each genotype: two pots each with 6 plants SMV strains: G1 - G7 Mechanical inoculation at unifoliolate leaf stage Evaluation of SMV Resistance

7 Linkage Analysis & Genetic Mapping Procedure of this Research Genotypic Data Obtaining Segregating Populations Phenotypic Data

8 J05 x Essex (Rsv1Rsv1Rsv3Rsv3) (rsv1rsv1rsv3 rsv3) F 1 (Rsv1rsv1Rsv3rsv3) F 2 X F 2 population and F 2:3 Lines (R) (S) SMV strain G1G7 Rsv1RN Rsv3SR G1 3R : 1S (3Rsv1_ : 1rsv1rsv1) 1R : 2Seg : 1S (1Rsv3Rsv3 : 2Rsv3rsv3 : 1rsv3rsv3) G7 F 2:3

9 J05 x Essex F 2 population SMV strain G1 R SExp.  2 R-gene : Rsv1 R = Resistant (symptomless) S = Susceptible (mosaic)

10 G1-susceptible F 2 plants (No Rsv1) SMV strain G1G7 Rsv1RN Rsv3SR RSeg.S Exp.  2 R-gene :2: Rsv3 R = Homozygous resistant (Rsv3Rsv3) S = Homozygous susceptible (rsv3rsv3) Seg. = Segregating (Rsv3rsv3) F 2:3 lines G7

11 Genetic map of the Rsv1 region MarkerLGPos (cM) Sat_297F59.6 Sat_229F62.8 Satt114F63.7 Sat_234F66.5 SOYHSP176F68.4 Sat_154F68.9 Satt510F71.4 Sat_317F73.0 Sat_120F76.0 Rsv Sat_297 Sat_229 Satt114 Sat_234 SOYHSP176 Sat_154 Satt510 Sat_317 Sct_ MLG F

12 P 1 =J05, P 2 =Essex, R = resistant, and S = susceptible plants of in the F 2 (J05 x Essex) SSR primer Satt114 for Rsv1 An example

13 Rsv1 Sat_154 Satt510 A genetic map for the Rsv1 region on MLG F 0.5 cM 2.3 cM Satt cM

14 Genetic maps of the Rsv3 region MarkerLG Pos (cM) Satt063B293.5 Satt560B297.9 Sat_424B Satt726B Satt687B Rsv3 Satt687 Satt063 Satt560 Sat_424 Satt726 MLG B

15 Polymorphisms among G1-susceptible plants of J05 x Essex F 2 amplified from Satt726 for Rsv3

16 Rsv3 Sat_424 Satt726 A genetic map for the Rsv3 region on MLG B2 1.5 cM 0.5 cM

17 SUMMARY I J05 contains two genes, Rsv1 on MLG F and Rsv3 on MLG B2, for resistance to SMV. Two genetic maps were constructed. Rsv3 Sat_424 Satt726 Rsv1 Sat_154 Satt510 MLG F MLG B2 1.5 cM 0.5 cM 2.3 cM Satt cM

18 II. A PCR-based Marker for the Rsv1 Locus Conferring Resistance to SWV Ainong Shi, Pengyin Chen, Cuiming Zheng, Anfu Hou, and Bo Zhang A PCR-based marker for the Rsv1 Locus conferring resistance to Soybean Mosaic Virus. Crop Sci. 48:

19 DNA fragments amplified from the primer pair Rsv1-f/r (Lane 1 to 8) on 1.3% agrose gel No.GenotypeGeneRsv1-f/r 1Essex - - 2PI 96983Rsv1 + 3MarshallRsv1-m + 4YorkRsv1-y - 5RaidenRsv1-r + 6KwanggyoRsv1-k + 7OgdenRsv1-t + 8Sweon 97Rsv1-h + M bp PCR-based Marker Rsv1-f/r in Rsv1 Locus

20 Amplification patterns of the marker with the primer pair Rsv1-f/r in the F 2 population derived from J05 x Essex on 1.3% agrose gel. R = resistant and S = susceptible plants in the F 2 Screen of Segregating Population R R R R R R R R R R R S R R R R S S S R R R S R R R R R R S S R S R R R

21 Amplification patterns of the DNA fragments with the SSR primer Satt 114 in the F 2 population derived from J05 x Essex on 6% non-denaturing polyacrylamide gel. P 1 =J05, P 2 =Essex, R = resistant, and S = susceptible plants in the F 2. Lane M is a 100 bp molecular-weight marker.

22 A genetic map around the 3gG2 gene between Sat_297 at cM to Sct_033 at cM of the Molecular Linkage Group (MLG) F Sat_297 Sat_229 Satt114 Sat_234 SOYHSP176 Sat_154 Rsv1-f/r: 3gG2 Satt510 Sat_317 Sct_ Rsv1

23 A pair of DNA primers Rsv1-f/r was developed from the candidate gene 3gG2 at the Rsv1 locus for SMV resistance All genotypes contained Rsv1, Rsv1-k, Rsv1-m,, Rsv1-n, Rsv1-r, Rsv1-s, and Rsv1-t produced the Rsv1-f/r fragment, but those carried Rsv1- y did not The fragment was neither amplified in only Rsv3 containing genotypes or only Rsv4 containing genotypes, nor in the susceptible genotypes SUMMARY II

24 III. Gene Pyramiding for SMV Resistance Using Molecular Markers J05 (Rsv1Rsv1Rsv3Rsv3) x V (Rsv4Rsv4) F 1 (Rsv1rsv1Rsv3rsv3Rsv4rsv4) x F 2:3 (3Rsv1:1rsv1)(3Rsv3:1rsv3)(3Rsv4:1rsv4) 1/64 Rsv1Rsv1Rsv3Rsv3Rsv4Rsv4 F 2:5 F 2:6 F 2:7 * Ainong Shi, Pengyin Chen, Dexiao Li, Cuiming Zheng, Anfu Hou, and Bo Zhang Gene pyramiding of genes of soybean mosaic virus resistance. Molecular Breeding 23(1):

25 Gore et al Genome 45: Jeong et al Crop Sci. 42: Cregan (http://bldg6.arsusda.gov/~pooley/soy/cregan/cregan.htm)

26 Satt510+Sat_317 (lane 1 & 2), Sat_154+Sat_317(lane 3 & 4), Satt063 (lane 5 & 6), Satt560 (lane 7 & 8), Satt266 (lane 9 & 10), and AI (lane 11 & 12). Lane M is a 100 bp DNA molecular ladder. M Six Polymorphic Markers between J05(Rsv1+3) and V (Rsv4) MarkerLinked Band gene J05 V (Rsv1,3) (Rsv4) Satt510+Sat_317 Rsv Sat_154+Sat_317Rsv Satt063Rsv312 Satt560 Rsv312 Satt266 Rsv412 AI856415Rsv412

27 PCR products amplified from 30 F 2:4 plants of J05 x V and two parents  Satt063 (Rsv3)  Sat_317  Satt510  Rsv1  Satt266 (Rsv4)

28 Polymorphism of Six SSR Markers in Five F 2:3 Plants Derived from J05 x V Rsv1Rsv3Rsv4 F 2:3 plantSatt510+ Sat_317 Sat_154+ Sat_317 Satt063Satt560Satt266AI JV-06G JV-06G JV-06G JV-06G JV-06G J05 (Rsv1+3) V (Rsv4) = same PCR fragment as in J05, 2 = same PCR fragment as in V , and 1+2 = both of J05 and V

29 Two SSR markers (Sat_154 and Satt510) and one gene-specific marker (Rsv1-f/r) were used for selecting plants containing Rsv1; Satt560 and Satt063 for Rsv3; and Satt266, AI856415, and AI g for Rsv4. Five F 4:5 lines were homozygous for all eight marker alleles and presumably carry all three SMV resistance genes that would potentially provide multiple and durable resistance to SMV. SUMMARY III

30 IV. Development of a Multiplex SNP Assay for Soybean Mosaic Virus Resistance Ainong Shi, Pengyin Chen, Richard Vierling, Innan Cervantes, and Ehsan Shakiba Development of multiplex SNP assays for selection of soybean mosaic virus resistance genes in soybean. World Soybean Research Conference VIII, August 10-15, 2009, Beijing, China.

31 EssexACCCTGCACTGCACTTCAAAT PI 96983ACCCTGCACTTCACTTCAAAT MarshallACCCTGCACTTCACTTCAAAT OgdenACCCTGCACTTCACTTCAAAT SNP Discovery Essex Ogden PI Marshall G T T T

32 1.Development of allele-specific SNP markers for 3gG2 (Rsv1) 2.Selection of allele-linked SNP markers for Rsv3, and Rsv4 3.Selection of SNP markers from soybean MLGs Content

33 3gG2 is the resistance allele at Rsv1 locus and the gene has been cloned and sequenced (Hayes et al. 2004). The sequence of 3gG2 was deposited in GenBank with the accession AY AAAGAAACATACACTCTAGCAGCAGGCACTAATGAAAATAGAGCACATTTTAAGGGAAGTAAGATGGTAG AGAAAGTAGTGAATGCTAGAAAATCAGGTGTGAATCAAATGGACAGAGAAACCAAAGCAAAAGCTTTCAA AATTAAACGTTTTAAAAAATACTAGTTAAACAATATGTCTAAAAATATTAAAAATTACTAAGAAACTATT AAAAATACTAGTTAAACAATTTATAGTGCCTTAAGATAATTTCTTCCTTTATAACTATTTAAATAACTAA TTTTTAATAAATAATAATTTTTGTATACTATTTTTACTCATAAAATTAAAACAAACAAGTGTTGGTTAAT ATCCCAAGAGGTACCCTCAGCAGAATCATAGCCACGCATTAATTCATGAAATACAGCTGTTAAAGTTTGT CTTGTTGGGAAGACTCAACAGATATTGGTTGACTCAATCTTAATTAAAGCCATCCTTCATAAAATTGCCT ATATTTAACAGATGAATTTTGTTCCCAATTTTTTTTTTATAAAGAATTGTCGTCTAAAAAAGTGTTTATT TCATTTTTCTTTTATTGCAAAGCTTTGAAATTGTTAAATGCGATTTTAGGCCCTAAATTAAATCTAACTA GAAGAGCTC 1. Develop Allele-specific SNP Marker for 3gG2 (Rsv1) 3gG2 – AY518517

34 3gG2 Gene Sequence Primer Design PCR Sequencing PCR Products Multiple Sequence Alignment SNP Discovery SNP ValidationSNP Genotyping Procedure for 3gG2-specific SNP markers

35 3gG2-AY Primer design Tool: Primer-BLAST PCR PCR Product Sequencing 3gG2-f1: TCAGCAGAATCATAGCCACG 3gG2-r1: CCAACACCACTTGCATTTTG (CAAAATGCAAGTGGTGTTGG)

36 Multiple Sequence Alignment - Tool - BioEdit

37 SNP Validation and Genotyping by Sequenom An example Soybean genotype SMV allele 3gG2 snp1 3gG2 snp2 EssexrsvG TA PI 96983Rsv1T C KwanggyoRsv1-kT C MarshallRsv1-mT C OgdenRsv1-tT C V262Rsv1-nT C Suweon 97Rsv1-hT C RaidenRsv1-rT C YorkRsv1-yG C DavisRsv1-yG C L29Rsv3G TC V Rsv4G TA V Rsv4G TA ViginiaRsv4G TA J05Rsv1+3T C HoureiRsv1+3T C PI Rsv1+4T C ColumbiaRsv3+4G TC Zao 18Rsv1-y+3G C Rsv1:[TT][CC] Rsv1-y:[GG][CC] [GT][CC]

38 2. Identify Allele-linked SNP Markers for Rsv3 and Rsv4 A519 GenBankA519snp1A519snp2 AF348331TATCCAAATAATAGTACCTCTACCCCTAAATGCTCAACCTTA AF125933TATCCAAATACTAGTACCTCTACCCCTAAATGCTCAACCTTA AF125932TATCCAAATAATAGTACCTCTACCCCTAAATGCTCAACCTTA AF125931TATCCAAATAATAGTACCTCTACCCCTAAATGCTCAACCTTA AF125930TATCCAAATAATAGTACCTCTACCCCTAAATGCTCAACCTTA AF125929TATCCAAATACTAGTACCTCTACCCCTAAATCCTCAACCTTA AF125928TATCCAAATACTAGTACCTCTACCCCTAAATCCTCAACCTTA AF125927TATCCAAATACTAGTACCTCTACCCCTAAATCCTCAACCTTA AF125926TATCCAAATACTAGTACCTCTACCCCTAAATCCTCAACCTTA AF125925TATCCAAATACTAGTACCTCTACCCCTAAATCCTCAACCTTA A519 Rsv3 0.8 CM AW307114A Rsv4 3.3 CM AW genbankAW307114snp1AW307114snp2 J05GGCAAAAAAAACCATCAATTGATTCTAACGGTGATTATTATT V GGCAAAAAAAACCATCAATTGATTCTAACGGTGATTATTATT L29GGCAAAAAAA-CCATCAATTGATTCTAACGGTGATTATTATT EssexGGCAAAAAAA-CCATCAATTGATTCTAACGGGGATTATTATT

39 SNP markerLGLocLinked gene BARC F68.11 Rsv1 BARC F68.85 Rsv1 BARC F69.85 Rsv1 BARC F69.9 Rsv1 BARC B Rsv3 BARC B290.8 Rsv3 BARC B Rsv3 BARC B Rsv3 BARC B Rsv3 BARC D1b45.98 Rsv4 BARC D1b48.73 Rsv4 BARC D1b51.92 Rsv4 BARC D1b54.89 Rsv4 3. Select SNP Markers from Soybean MLGs SNP markers from the Soybean Linkage Map – 2006 (http://bfgl.anri.barc.usda.gov/soybean/index.html)

40 SNP genotyping in Soybean by Sequenom An example Soybean Linked to Rsv1Linked to Rsv3Linked to Rsv4 3gG2- snp1 F N11PFA519d B D1b D1b AW Da bai maG TC T A d EssexG TC T C C TA d J05T C T A Jindou1G A T C TG A d Jiunong 21G TA T C TA G d Kefeng No. 1T A T G A KwanggyoT C G T C TG A L29G TA T 0 T G d MarshallG TA T C C TG A OgdenG TA T C C TA G A PI T C G C C TA G d PI 96983T C T C TA G A RaidenT C G C C TA G d Suweon 97T C G C C TA G d V262T C G C C TA d V G TC T A ViginiaG TA T G A d YorkG A T C C TG A d Zho 18G C T C TG A d

41 SNP Genotyping in J05 x Essex F 2 population J05 contains two SMV resistance genes Rsv1 and Rsv3 Rsv1 in J05 is co-segregated with the SNP marker 3gG2snp, unlinked to SNP A519snp and AW307114snp1 Rsv3 in J05 is co-segregated with SNP A519snp and unlinked to AW307114snp1 LocusPhenotype χ 2 A (3:1) χ 2 B (1:2:1) χ 2 AB (3:6:3:1:2:1) ABRM11RM12RM22SM11SM12SM22 Rsv13gG2snp ** Rsv1A519snp Rsv1AW307114snp Rsv33gG2snp (1:0) - Rsv3A519snp ** Rsv3AW307114snp

42 2 SNP markers were identified from the 3gG2 gene at Rsv1 locus 4 SNPs near Rsv1, 5 near Rsv3, and 5 near Rsv4 were validated The inheritance mode in two F 2 populations (J05 x Essex and Jindou1 x Essex) were tested by the SNP assay and verified these SNP markers were useful in idenfication and selection of SMV resistance genes SUMMARY IV

43 ACKNOWLEDGEMENTS University of Arkansas: Dr. Pengyin Chen, Dr. Rose Gergerich, Dr. Cuiming Zheng, Dr. Bo Zhang, Dr. Anfu Hou, Dr. Tetsuaki Ishabahi, Dexiao, Ehsan, Innan, Justin, Caroline, Tina, Leandro, Andrew, Liliana, Julieta, Xiaoyu, Luciano, Moldir, Michael, Mioko, Takuro, Yoko, and Bryan. ICIA and Purdue University: Dr. Rick Vierling, Larry Svajgr, Alan Galbreth, Pam Hogue, Karan Miller, and Rachael Sondeno

44 Thank you! Personal web site


Download ppt "Breeding and Genetics of Soybean Mosaic Virus Resistance in Soybean Ainong Shi Syngenta Seeds Slater, IA USA Pengyin Chen University of Arkansas Fayetteville,"

Similar presentations


Ads by Google