Presentation is loading. Please wait.

Presentation is loading. Please wait.

Tomasz Stadejek Impact of PRRSV diversity on diagnostic activities.

Similar presentations


Presentation on theme: "Tomasz Stadejek Impact of PRRSV diversity on diagnostic activities."— Presentation transcript:

1 Tomasz Stadejek Impact of PRRSV diversity on diagnostic activities

2

3

4 Russia Belarus Lithuania Western Europe, Asia, North America ORF5 identity down to 69.5% (Clustal V) ORF7 identity down to 75.4% (Clustal V) Type 1 PRRSV (European) belongs to several distinct subtypes

5 Type 1, subtype 2: 378, 375 Type 1, subtype 4: 375 Type 1, subtype 1: 387, 390, 399 Type 1, subtype 3: 375, 387 Type 2: 372, 375 Type 1, atypical?: 393 Type 1, atypical?: 378 +----- ----+--------- +------- --+--------- +---------+---------+------- 30 40 130 140 360 370 380 +----- ----+--------- +------- --+--------- +---------+---------+------- subtype 1 Lelystad 1991 NL-387 AAAGAA---AAGTACAGCTCCGA GGACAGGC---CAAAAAGAAAAA TACATCCGCCAGTCAGGGTGCAAGTTAA subtype 1_776 RO-390 variant AAAAAACAAAAACACAGCTCCGA GGACAGGC---AAAAAGGAAAAA TGCATCCGCCAGTCAGGGTGCAAGTTAA subtype 1_28M_2009 SK-399 variant GAAGAA---AAGTACAGCTCCAA GGACAGGC---CAGAAAGAAAAA CACATCCGCGAGTCAGGGTGCAAGTCAATTTGGTAGTTAG subtype 2 IL-1999 RU-378 AAATAA---AAATACAGCTCCAA GGACGGGCTAATAAAAAGAGGAA CGCATCTGCCAGTTAA subtype 2 Ili 2_2009 RU-375 variant AAACAA---AAATACAGCTCCAA GGACGGGT---TAAAAAGAGGAA CGCATCCGCCAGTTAG subtype 3 Soz 2004 BY-375 AAAGAA---AAATACAGCTCCAA GGACAGGA---AAAAAAAAAAAG CACGCCCGTTAGTTAA subtype 3 Soz_2009_BY-387 variant AAAGAA---AAGTACAGCTCCAA GGACAGGA---AAAAAGGAAAAG CACGCCCACTAGTCAAGGCGCAAGTTAA subtype 4_Okt BY-375 AAAGAA---AAATGTAGCTCCAA GGACAGGC---CAAAAGGAAAAA TACATCCAATAGTTAG atyp Bor-54 BY-393 AAATAA---AAACACAGCTCTAA GGACAGGCTCACAAAAGGAAAAA CGCACCCAATGATTTGGGCGCAACTCAATAG atyp VL RU-378 ACAAATCAAAAACACAACTCCAA GGACAGGC---CAAAAAGAAAAG CGCGCCTGCTAGTTAA ORF7 polymorphism

6 LV 40 50 Lelystad 387sub1 QPRGGQA-KKKKP Czechy_47 387sub1_070118 QPRGGQA-RKKRP AS_34M 387sub1EE QPRGGQA-KKKKP Eigir LT 2006 378sub2 QPRGGQASKRKKP Ili_6_100210 378sub2 QPRGGRVNKRKKP Ili_9_100210 375sub2 QPRGGRV-KKRKP Zad_1_041201 375sub3 QPRGGQA-KKKKP Obu_1_050310 375sub3 QPRGGQA-KKKRP Yuz_34_050310 375sub3 QPRGGQA-KKKRP Soz_091120 387sub3STOPCOD QPRRGQE-KRKRP Soz 2A_85_85_060215 375sub3 QPRRGQG-IKKKP Okt-46 375atyp QPKGGQA-KRKKP Bor_59 393atyp_091209 QPRGGQANKRKKP 2 1 3

7 StrainType 1 subtype SDOW17 (EU+NA) VO17 (NA)WB4 (EU) 231/Sza3 ++- 415/Andnd --+ 6695/Bie2 +-+ 8380/Okt4 ++- Boratypical ++- Courtesy of Anette Botner

8 Vietnamese PHFD PRRSV isolate Belarusian subtype 3 PRRSV isolate

9 NADIR experiment DTU Vet Lindholm, Denmark To assess virulence of east European variants of type 1 PRRSV PAM isolation Pigs free from 29 known pig pathogens, intranasally inoculated 4 groups –7 pigs inoculated with Danish isolate 18794 subtype 1 –7 pigs inoculated with Russian isolate Ili subtype 2 –7 pigs inoculated with Belarusian atypical isolate Bor –7 pigs sham inoculated Monitored for 24 dpi 9 9 VET LIndholm

10 Development of body temperature in pigs infected with type 1 PRRSV strains 10 VET LIndholm Courtesy of Jens Nielsen 18794 (subtype 1) Ili (subtype 2) Bor (atypical) controls

11 Can wild boars transmit East European strains westward? Stankevicius et al., Barcelona 2011 11ESVV 2012, Sep 5, Madrid

12

13 Toplak et al.: J Vir Meth TaqVet PRRS Triplex (LSI) Adiavet PRRS EU/NA (Adiagene) NextGen PRRS (Tetracore) 13

14

15 ESVV 2012, Sep 5, Madrid15

16 Genotype 2 PRRSV in Europe Poland 98.7% Poland 98% Spain 97.7% Hungary 95.7% Poland 93.7% Hungary 87.7% % identity to Ingelvac PRRS MLV Clustal W Germany 96% Poland 96.2% Germany 91.2%

17 Discriminatory ELISA in a herd co-infected with two genotypes

18 ELISA specificity issues with sow sera Farm in house IDEXX 2XR IDEXX X3 ING Universal ING Europa ING America ING DR ING Compac CIVTEST E CIVTEST A Korea 10/15740 (22) 0%4,5%0%13,6%9,1% 90,9% 9,1%0%4,5% 63,6% 45,5 % 10/15738 (36) 0%Nd0% 22,2% 0% 19,4 % 0%2,8%13,9% 61,1 % singletons (13) 7,8% 76,9% 0% 15,4% 0% 84,6%38,5% 0%

19 ESVV 2012, Sep 5, Madrid19 Jens Nielsen Anette Botner Martin Oleksiewicz Torben Storgaard Arunas Stankevicius Denis Potapchuk Alexei Scherbakov Ewelina Skrzypiec Katarzyna Szymanek Michal Fabisiak Rafal Sapierzynski Katarzyna Podgorska Artur Jablonski Marian Porowski Iwona Stankiewicz Thank you! Lars E. Larsen Lise Kvisgaard Gyula Balka Daniel Cadar Gabi Schageman Oliver Duran Fred Leung Manreet Brar Jose Angulo Mike Roof Eric Nelson Rolf Rauh


Download ppt "Tomasz Stadejek Impact of PRRSV diversity on diagnostic activities."

Similar presentations


Ads by Google