Presentation is loading. Please wait.

Presentation is loading. Please wait.

Very Short Dispersed Repeats

Similar presentations


Presentation on theme: "Very Short Dispersed Repeats"— Presentation transcript:

1 Very Short Dispersed Repeats
Also, palindromes

2 What are they? Short sequences (between 4 and 13-ish nucleotides) – one might even say they’re very short Occur multiple times in the genome, at dispersed intervals (not repeated right next to each other) – “distributed or spread over a wide interval”

3 It turns out that many of these very short dispersed sequences are palindromic – what does that mean? The sequence is read the same in the 5’  3’ direction as it is in the 3’  5’ direction.

4 Occurrence of Highly Iterated Palindromes (HIP1) in Cyanobacteria

5 Palindromic Sequence in Cyanobacteria 5’-GCGATCGC-3’ 3’-CGCTAGCG-5’
But not all cyanobacteria have this sequence

6

7 Blast Search What is the purpose of HIP1?
ATGCATGATACGTAGCGATCGCCACCCGGGATTGCGATCGC Match: GCGATCGC What genes are nearby? Prior research shows DAM methylase recognition and DNA profiling

8 Thermosynechococcus elongatus BP1 & Synechococcus Elongatus PCC 6301

9 Prochlorococcus marinus mit9301 & Trichodesmium Erythraeum IMS101

10 Results? Hypothetical Proteins-highest peak in Themosynechococcus and Trichodesmium Many metabolic proteins such as Ferredoxin, peptidase Program to overlap nearby genes in different organisms

11 References Robinson, P. J., Cranenburgh, R. M., Head, I. M. and Robinson, N. J. (1997), HIP1 propagates in cyanobacterial DNA via nucleotide substitutions but promotes excision at similar frequencies inEscherichia coli and Synechococcus PCC Molecular Microbiology, 24: 181–189.  Robinson, P. J., Gupta, A., Bleasby, A., Whitton, B., Morby, AP. Singular over- representation of an octameric palindrome, HIP1, in DNA from many cyanobacteria Moya, A. Delaye, L. Abundance and distribution of the highly iterated palindrome 1(HIP1) among prokaryotes Mob Genet Elements Sep-Oct; 1(3)

12 Occurrences of DNA uptake sequence from Haemophilus influenzae in other Pasteurellaceae bacteria
By: Noha Mudhaffar

13 AAGTGCGGT 1516 (479 – 1001)

14 Highly Repeated Sequences

15 Family: Pasteurellaceae

16 Actinobacillus-succinogenes-130Z 1690 Haemophilus-influenzae-86-028NP
Organism Length GC-FRACTION Occurrences of DNA USS Actinobacillus-succinogenes-130Z 1690 Haemophilus-influenzae NP 1516 Actinobacillus-actinomycetemcomitans-HK1651 1507 Mannheimia-succiniciproducens-MBEL55E 1485 Haemophilus-influenzae-R2846 1461 Haemophilus-somnus-2336 1355 Haemophilus-somnus-129PT 1245 Haemophilus-influenzae-R2866 952 Pasteurella-multocida-subsp-multocida-str-Pm70 927 Haemophilus-influenzae-86028NP 888 Haemophilus-influenzae-Rd-KW20 737 Actinobacillus-pleuropneumoniae-L20 73 Actinobacillus-pleuropneumoniae-serovar-1-str-4074 63 Mannheimia-haemolytica 59 Haemophilus-ducreyi-35000HP 41

17 Organism Length GC-FRACTION Occurrences of DNA USS Escherichia-coli-DH10B 19 Escherichia-coli-53638 22 Escherichia-coli-HS 5 Escherichia-coli-E24377A Escherichia-coli-E 18 Escherichia-coli-F11 Escherichia-coli-042 24 Escherichia-coli-E110019 17 Escherichia-coli-K12 23 Escherichia-coli-O157-H7 27 Escherichia-coli-B7A 15 Escherichia-coli-APEC-O1 14 Escherichia-coli-B171 Escherichia-coli-CFT073 7 Escherichia-coli-W3110 Escherichia-coli-E22 Escherichia-coli-O157-H7-EDL933 10 Escherichia-coli-ATCC-8739

18 Reference Frequency and Distribution of DNA Uptake Signal Sequences in the Haemophilus influenzae Rd Genome. Genomic Sequence of an Otitis Media Isolate of Nontypeable Haemophilus influenzae: Comparative Study with H. influenzae Serotype d, Strain KW20. Xu Z, Yue M, Zhou R, Jin Q, Fan Y, et al. (2011) Genomic Characterization of Haemophilus parasuis SH0165, a Highly Virulent Strain of Serovar 5 Prevalent in China. PLoS ONE 6(5): e doi: /journal.pone DNA uptake signal sequences in naturally transformable bacteria.

19 The Evolutionary Change of DNA Uptake Sequences in Neisseria meningitides.

20 What are DNA Uptake Sequences (DUS)?
Neisseria sp. Constitute ~1% of genome. Homology 5’GCCGTCTGAA’3 Kingdom: Bacteria Phylum: Proteobacteria Class: Betaproteobacteria Order: Neisseriales Family: Neisseriaceae Genus: Neisseria Species:Neisseria meningitidis

21 DNA Uptake Sequence AT-DUS AG-DUS

22 A Closer Look Strain # of DUS DUS Sequence G+C (%)
Length of Genome (bp) N. meningitidis MC58 1477 5’ATGCCGTCTGAA’3 51.5 N. Meningitidis Z2491 1449 5’AGGCCGTCTGAA’3 51.8 N. Gonorrhoeae FA1090 1522 52.7

23 DUS Inversion

24 Phylogeny 16s rRNA DUS

25 References http://phil.cdc.gov/phil/details.asp?pid=2678
Frye SA, Nilsen M, Tønjum T, Ambur OH. Dialects of the DNA uptake sequence in Neisseriaceae. PLoS Genet. 2013

26 Six nucleotide palindromic sequences in Mycobacteriophage genomes
What about them? That’s a great question. I’m glad you asked.

27 How did we get here from Very Short Dispersed Repeats
How did we get here from Very Short Dispersed Repeats? A very short story. Point A: “Singular over-representation of an octameric palindrome, HIP1, in DNA from many cyanobacteria.” From there: what about palindromes in mycobacteriophages? ?

28 Avoidance of 6 nt palindromes in Mycobacteriophages
Mycobacterial genomes generally do not avoid 6 palindrome sequence. Generally, this means that the viruses that infect them will not either. When two of the mycobacteriophage genomes were examined, they were found to avoid palindromes of size 6. “The sole exception is provided by the two M. tuberculosis phages D29 and L5, which strongly avoid palindromes of size 6.” (Rocha, et. al) 2001 L5 and D29 – Mycobacteriophage cluster A2

29 Generated 186 random sequences of the same length of the average Mycobacteriophage genome (70627 nucleotides long) and same GC content (64%) and counted the number of occurrences of all 6 nucleotide palindromes in these randomly generated sequences.

30 Occurrences of all 6 nucleotide palindromes over the actual genomes of Mycobacteriophages (or at least the 186 that BioBIKE knows)

31 All of the cluster C1 phages in BioBIKE!
Which phages are outliers to the right? (>2000 occurrences) - these 15 All of the cluster C1 phages in BioBIKE! ((Mycobacterium-phage-Cali 2485) – C, C1 (Mycobacterium-phage-Catera 2466) – C, C1 (Mycobacterium-phage-Alice 2437) – C, C1 (Mycobacterium-phage-LRRHood 2445) – C, C1 (Mycobacterium-phage-Rizal 2465) – C, C1 (Mycobacterium-phage-Nappy 2528) – C, C1 (Mycobacterium-phage-Ghost 2524) – C, C1 (Mycobacterium-phage-Drazdys 2506) – C, C1 (Mycobacterium-phage-ScottMcG 2480) – C, C1 (Mycobacterium-phage-Spud 2485) – C, C1 (Mycobacterium-phage-Sebata 2519) – C, C1 (Mycobacterium-phage-Pio 2505) - C, C1 (Mycobacterium-phage-Bxz1 2501) – C, C1 (Mycobacterium-phage-LinStu 2478) – C, C1 (Mycobacterium-phage-ET )) – C, C1

32 What’re C1 cluster phages?
“Only two of these (Subclusters C1 and C2) correspond to phages with myoviral morphologies (with contractile tails)” Okay, so they’re of the family Myoviridae. This means they are: generally lytic, and lack the necessary genes to become lysogenic. They have a contractile tail, and contracting the tail requires ATP. C cluster phage isolated by Michael Kiflezghi!

33 Which sequences are occurring so frequently?
GGCGCC GACGTC CGCGCG ACCGGT GTCGAC GCGCGC CCCGGG TGGCCA CAGCTG AGGCCT CGATCG CTGCAG TGCGCA Many of these are recognition sites for restriction enzymes. Significant? There’s a chance. Warrants more investigation? It seems likely.

34 References and credit for pictures
phagesdb.org Rocha, E., Danchin, A., & Viari, A. (2001). Evolutionary role of Restriction/Modification systems as revealed by comparative genome analysis. Genome Research, (11), doi: /gr Discussion of avoidance of palindromic sequences of length 4 and 6 and possible reasons for this avoidance in bacteria and bacteriophages. Mentions 2 mycobacteriophages that exhibit an avoidance for 6nt palindromes, L5 and D29. Article Source: Expanding the Diversity of Mycobacteriophages: Insights into Genome Architecture and Evolution. Pope WH, Jacobs-Sera D, Russell DA, Peebles CL, Al-Atrache Z, et al. (2011) Expanding the Diversity of Mycobacteriophages: Insights into Genome Architecture and Evolution. PLoS ONE 6(1): e doi: /journal.pone cyanobacteria picture: mycobacteriophage picture: coral snake:


Download ppt "Very Short Dispersed Repeats"

Similar presentations


Ads by Google