Presentation is loading. Please wait.

Presentation is loading. Please wait.

Very Short Dispersed Repeats Also, palindromes. What are they?  Short sequences (between 4 and 13-ish nucleotides) – one might even say they’re very.

Similar presentations


Presentation on theme: "Very Short Dispersed Repeats Also, palindromes. What are they?  Short sequences (between 4 and 13-ish nucleotides) – one might even say they’re very."— Presentation transcript:

1 Very Short Dispersed Repeats Also, palindromes

2 What are they?  Short sequences (between 4 and 13-ish nucleotides) – one might even say they’re very short  Occur multiple times in the genome, at dispersed intervals (not repeated right next to each other) – “distributed or spread over a wide interval”

3 It turns out that many of these very short dispersed sequences are palindromic – what does that mean? The sequence is read the same in the 5’  3’ direction as it is in the 3’  5’ direction.

4 Occurrence of Highly Iterated Palindromes (HIP1) in Cyanobacteria

5 Palindromic Sequence in Cyanobacteria 5’-GCGATCGC-3’ 3’-CGCTAGCG-5’ But not all cyanobacteria have this sequence

6

7 Blast Search What is the purpose of HIP1?  ATGCATGATACGTAGCGATCGCCACCCGGGATTGCGATCGC  Match: GCGATCGC  What genes are nearby?  Prior research shows DAM methylase recognition and DNA profiling

8 Thermosynechococcus elongatus BP1 & Synechococcus Elongatus PCC 6301

9 Prochlorococcus marinus mit9301 & Trichodesmium Erythraeum IMS101

10 Results?  Hypothetical Proteins-highest peak in Themosynechococcus and Trichodesmium  Many metabolic proteins such as Ferredoxin, peptidase  Program to overlap nearby genes in different organisms

11 References  Robinson, P. J., Cranenburgh, R. M., Head, I. M. and Robinson, N. J. (1997), HIP1 propagates in cyanobacterial DNA via nucleotide substitutions but promotes excision at similar frequencies inEscherichia coli and Synechococcus PCC 7942. Molecular Microbiology, 24: 181–189.  Robinson, P. J., Gupta, A., Bleasby, A., Whitton, B., Morby, AP. Singular over- representation of an octameric palindrome, HIP1, in DNA from many cyanobacteria  Moya, A. Delaye, L. Abundance and distribution of the highly iterated palindrome 1(HIP1) among prokaryotes Mob Genet Elements. 2011 Sep-Oct; 1(3) 159-168

12 O ccurrences of DNA uptake sequence from Haemophilus influenzae in other Pasteurellaceae bacteria By: Noha Mudhaffar

13 AAGTGCGGT  1516 (479 – 1001)  1913428  0.3815231

14 Highly Repeated Sequences

15 Family: Pasteurellaceae

16 Organism LengthGC-FRACTION Occurrences of DNA USS Actinobacillus-succinogenes- 130Z 23196630.44918594 1690 Haemophilus-influenzae-86- 028NP 19134280.3815231 1516 Actinobacillus- actinomycetemcomitans- HK1651 1995520 0.44412282 1507 Mannheimia- succiniciproducens-MBEL55E 23140780.42537978 1485 Haemophilus-influenzae- R2846 18242420.37971717 1461 Haemophilus-somnus-2336 2263857 0.37378067 1355 Haemophilus-somnus-129PT 20128780.37191722 1245 Haemophilus-influenzae- R2866 19333400.38079283 952 Pasteurella-multocida- subsp-multocida-str-Pm70 22574870.40404883 927 Haemophilus-influenzae- 86028NP 17388640.38510486 888 Haemophilus-influenzae-Rd- KW20 1830138 0.38147888 737 Actinobacillus- pleuropneumoniae-L20 22744820.41299513 73 Actinobacillus- pleuropneumoniae-serovar- 1-str-4074 22923480.41376877 63 Mannheimia-haemolytica 24984060.40754706 59 Haemophilus-ducreyi- 35000HP 16989550.38220495 41

17 Organism LengthGC-FRACTION Occurrences of DNA USS Escherichia-coli-DH10B 5004529 0.510349919 Escherichia-coli-53638 5289471 0.509568522 Escherichia-coli-HS4643538 0.5081961 5 Escherichia-coli-E24377A 4980187 0.5062159319 Escherichia-coli-E2348-69 5059346 0.505074218 Escherichia-coli-F115206906 0.504968219 Escherichia-coli-042 5379979 0.5053263324 Escherichia-coli-E110019 5384084 0.507715717 Escherichia-coli-K12 4639221 0.5078887323 Escherichia-coli-O157-H7 5594477 0.504841627 Escherichia-coli-B7A 5202558 0.508480415 Escherichia-coli-APEC-O1 5497653 0.503381214 Escherichia-coli-B171 5299753 0.5071353319 Escherichia-coli-CFT073 5231428 0.50474805 7 Escherichia-coli-W3110 4646332 0.507995822 Escherichia-coli-E22 5516160 0.50639722 Escherichia-coli-O157-H7- EDL933 5528445 0.503829710 Escherichia-coli-ATCC- 8739 4746218 0.508665223

18 Reference  Frequency and Distribution of DNA Uptake Signal Sequences in the Haemophilus influenzae Rd Genome.  Genomic Sequence of an Otitis Media Isolate of Nontypeable Haemophilus influenzae: Comparative Study with H. influenzae Serotype d, Strain KW20.  Xu Z, Yue M, Zhou R, Jin Q, Fan Y, et al. (2011) Genomic Characterization of Haemophilus parasuis SH0165, a Highly Virulent Strain of Serovar 5 Prevalent in China. PLoS ONE 6(5): e19631. doi:10.1371/journal.pone.0019631.  DNA uptake signal sequences in naturally transformable bacteria.

19 The Evolutionary Change of DNA Uptake Sequences in Neisseria meningitides.

20 What are DNA Uptake Sequences (DUS)?  Neisseria sp.  Constitute ~1% of genome.  Homology  5’GCCGTCTGAA’3  Kingdom: Bacteria  Phylum: Proteobacteria  Class: Betaproteobacteria  Order: Neisseriales  Family: Neisseriaceae  Genus: Neisseria  Species:Neisseria meningitidis

21 DNA Uptake Sequence  AT-DUS  AG-DUS

22 A Closer Look Strain# of DUS DUS SequenceG+C (%)Length of Genome (bp) N. meningitidis MC58 14775’ATGCCGTCTGAA’351.52272351 N. Meningitidis Z2491 14495’AGGCCGTCTGAA’351.82184406 N. Gonorrhoeae FA1090 15225’ATGCCGTCTGAA’352.72153922

23 DUS Inversion

24 Phylogeny 16s rRNA DUS

25 References  http://phil.cdc.gov/phil/details.asp?pid=2678 http://phil.cdc.gov/phil/details.asp?pid=2678  Frye SA, Nilsen M, Tønjum T, Ambur OH. Dialects of the DNA uptake sequence in Neisseriaceae. PLoS Genet. 2013

26 Six nucleotide palindromic sequences in Mycobacteriophage genomes What about them? That’s a great question. I’m glad you asked.

27 How did we get here from Very Short Dispersed Repeats? A very short story.  Point A: “Singular over-representation of an octameric palindrome, HIP1, in DNA from many cyanobacteria.”  From there: what about palindromes in mycobacteriophages? ?

28 Avoidance of 6 nt palindromes in Mycobacteriophages Mycobacterial genomes generally do not avoid 6 palindrome sequence. Generally, this means that the viruses that infect them will not either. When two of the mycobacteriophage genomes were examined, they were found to avoid palindromes of size 6. “The sole exception is provided by the two M. tuberculosis phages D29 and L5, which strongly avoid palindromes of size 6.” (Rocha, et. al) 2001 L5 and D29 – Mycobacteriophage cluster A2

29 Generated 186 random sequences of the same length of the average Mycobacteriophage genome (70627 nucleotides long) and same GC content (64%) and counted the number of occurrences of all 6 nucleotide palindromes in these randomly generated sequences.

30 Occurrences of all 6 nucleotide palindromes over the actual genomes of Mycobacteriophages (or at least the 186 that BioBIKE knows)

31 Which phages are outliers to the right? (>2000 occurrences) - these 15 ((Mycobacterium-phage-Cali 2485) – C, C1Mycobacterium-phage-Cali (Mycobacterium-phage-Catera 2466) – C, C1Mycobacterium-phage-Catera (Mycobacterium-phage-Alice 2437) – C, C1Mycobacterium-phage-Alice (Mycobacterium-phage-LRRHood 2445) – C, C1Mycobacterium-phage-LRRHood (Mycobacterium-phage-Rizal 2465) – C, C1Mycobacterium-phage-Rizal (Mycobacterium-phage-Nappy 2528) – C, C1Mycobacterium-phage-Nappy (Mycobacterium-phage-Ghost 2524) – C, C1Mycobacterium-phage-Ghost (Mycobacterium-phage-Drazdys 2506) – C, C1Mycobacterium-phage-Drazdys (Mycobacterium-phage-ScottMcG 2480) – C, C1Mycobacterium-phage-ScottMcG (Mycobacterium-phage-Spud 2485) – C, C1Mycobacterium-phage-Spud (Mycobacterium-phage-Sebata 2519) – C, C1Mycobacterium-phage-Sebata (Mycobacterium-phage-Pio 2505) - C, C1Mycobacterium-phage-Pio (Mycobacterium-phage-Bxz1 2501) – C, C1Mycobacterium-phage-Bxz1 (Mycobacterium-phage-LinStu 2478) – C, C1Mycobacterium-phage-LinStu (Mycobacterium-phage-ET08 2466)) – C, C1Mycobacterium-phage-ET08 All of the cluster C1 phages in BioBIKE!

32 What’re C1 cluster phages?  “Only two of these (Subclusters C1 and C2) correspond to phages with myoviral morphologies (with contractile tails)”  Okay, so they’re of the family Myoviridae. This means they are: generally lytic, and lack the necessary genes to become lysogenic. They have a contractile tail, and contracting the tail requires ATP. C cluster phage isolated by Michael Kiflezghi!

33 Which sequences are occurring so frequently? GGCGCCGACGTCCGCGCGACCGGT GTCGACGCGCGCCCCGGG TGGCCACAGCTGAGGCCT CGATCGCTGCAGTGCGCA Many of these are recognition sites for restriction enzymes. Significant? There’s a chance. Warrants more investigation? It seems likely.

34 References and credit for pictures  phagesdb.org  Rocha, E., Danchin, A., & Viari, A. (2001). Evolutionary role of Restriction/Modification systems as revealed by comparative genome analysis. Genome Research, (11), 946-958. doi:10.1101/gr.153101 Discussion of avoidance of palindromic sequences of length 4 and 6 and possible reasons for this avoidance in bacteria and bacteriophages. Mentions 2 mycobacteriophages that exhibit an avoidance for 6nt palindromes, L5 and D29.  Article Source: Expanding the Diversity of Mycobacteriophages: Insights into Genome Architecture and Evolution. Pope WH, Jacobs-Sera D, Russell DA, Peebles CL, Al-Atrache Z, et al. (2011) Expanding the Diversity of Mycobacteriophages: Insights into Genome Architecture and Evolution. PLoS ONE 6(1): e16329. doi: 10.1371/journal.pone.0016329Expanding the Diversity of Mycobacteriophages: Insights into Genome Architecture and Evolution  cyanobacteria picture: http://www.um.edu.mt/__data/assets/image/0005/166604/oculatella2.jpg http://www.um.edu.mt/__data/assets/image/0005/166604/oculatella2.jpg  mycobacteriophage picture: http://openi.nlm.nih.gov/imgs/512/165/2884959/2884959_2711fig1.png http://openi.nlm.nih.gov/imgs/512/165/2884959/2884959_2711fig1.png  coral snake: http://upload.wikimedia.org/wikipedia/commons/8/8a/Coral_snake.jpg


Download ppt "Very Short Dispersed Repeats Also, palindromes. What are they?  Short sequences (between 4 and 13-ish nucleotides) – one might even say they’re very."

Similar presentations


Ads by Google