Presentation is loading. Please wait.

Presentation is loading. Please wait.

Development of proteomics tools to study intranuclear organization

Similar presentations


Presentation on theme: "Development of proteomics tools to study intranuclear organization"— Presentation transcript:

1 Development of proteomics tools to study intranuclear organization
Vasily Ogryzko Group of “Proteomics & epigenetics’, UMR 8126 CNRS, Institut Gustave Roussy 15 мая 2014 Программа визитов иностранных учёных в российские научные центры фонда "Династия"

2 Importance of proteomics
One genome Two proteomes

3 Proteomics: Questions: Methodology: Proteins: Structure Levels
High throughput Study of proteins Questions: Amounts Localization Modifications Interactions Methodology: 2D electrophoresis Mass spectrometry Epitope tagging Proteins: Structure Levels

4 Challenges of postgenomic era:
Study post-transcriptional steps in gene regulation (microRNA, etc) Decipher mechanisms of epigenetic regulation (histone code, other self-perpetuating protein modifications) Predict function of newly discovered genes (protein-protein interaction partners) can be addressed by proteomics

5 Healthcare - Research - Education Clinical Research Division
International Scientific Advisory Board Hospital Activities Research Division Clinical Research Division (DRC) Research Units (IRCIV)

6 Technology Transfert Company
Platforms Jean-Yves Scoazec Imaging / flow cytometry Animal facility Integrated biology Translational research Tumor collection Biotherapies Bioinformatics Research Division Eric Solary Scientific Policy Committee Clinical Research Gilles Vassal Steering Committee Research Units Research Coordination and Management Service / Logistics Service Technology Transfert Company

7 Proteomics platform at IGR
Integrated Biology Proteomics platform Lipidomics Metabolomics Functional genomics Bioinformatics Biological resources center

8 Proteomics platform at IGR
Vasily OGRYZKO – DR2, INSERM Emilie COCHET – Technicienne, IGR Alain DEROUSSENT– IR, CNRS Geographic location: IGR, PR2, room 355 Personnel:

9 Proteomics platform at IGR
Main instrument: Nano-HPLC/CHIP/ion-trap (Agilent) + Agilent off-gel separator for preanalytic fractionation Small laboratory equipment

10 Epigenetic information can be encoded in macromolecular interactions
1. Protein footprinting: motivation Epigenetic information can be encoded in macromolecular interactions Proteins are much more interesting objects than DNA or RNA, i.e. not only their amounts but their conformation and interaction plays essential role

11 Protein footprinting: motivation
Biological system as: Chemical reactor Mechanical device Concentrations (quantities) are all what we need Quantities will tell us nothing

12 Proteome footprinting: motivation
Comparing only protein amounts between proteomes might be looking at the tip of the iceberg 1. Chemical reactor versus machine 2. Differences in protein amounts do not show immediately in many cases, unlike changes in conformations or interactions Need to develop quantitative approaches to monitor changes in protein surfaces in vivo

13 Protein/proteome footprinting: the principle
Modification Identification of modified site Isolated Interacting Protease Mass spec Goals: 1. Monitor surface of a particular protein in vivo 2. Detect changes in protein surfaces on proteome-wide basis

14 Lysine containing peptide: mono-, di- and trimethylation by DMS
14

15 Arginine containing peptide: mono- and dimethylation by DMS
14 1methyl 2methyl

16 Stable isotope DMSD6 produces a mass shift 17 instead of 14
CH3 14 17 CD3

17 Discrimination between in vitro and in vivo methylation using
stable isotopes KCH3 KCD3 KCH3

18 Footprinting of H2AZ expressed in bacteria
Total spectra ,867

19 Footprinting of H2AZ expressed in bacteria
658 850 1370 TTSHGR HLQLAIR ATIAGGGVIPHIHK

20 Footprinting of H2AZ/H2B dimer in vitro
+CH3 828.4 +CD3 1168.6 850.5 1370.8

21 (affinity enrichment)
DMSD6 Trypsin, (affinity enrichment) LC-MS/MS DMS Denaturation B 1 2 3 Ctrl 1 2 5 DMS 3 10 4 coomassie

22 Conclusions Methodology: 1. DMS methylates proteins in vivo
2. Use of stable isotope DMSD6 allows to set up a quantitative approach to monitor reactivity of residues in vivo and in vitro 3. H2AZ and H2B surfaces change after forming H2AZ/H2B dimer

23 2. New proteomics-based strategy to study
protein-protein interactions in vivo Proximity-Utilizing-Biotinylation (PUB)

24 Proximity-Utilizing-Biotinylation (PUB) for study interactions between known interaction partners
Interaction between protein A and B causes biotin transfer and its covalent binding to Lysine of BAD Protein А wtBirA B BAD Protein В wtBirA 2. Purification of all HisTag proteins On Ni agarose beads, propionic anhydride treatment, trypsin digest B Р Biotin ligase (wild type) BAD BAD BAD Biotin Accepting Domain (Short peptide with HisTag) 3. LC-MS/MS Analysis of ratio Biotinylated/propionylated peptides Biotin residue Biotinilated propionilated I Retention time (min) B Propionyl residue P 24

25 Biotinylation levels are interaction dependent
Protein oligomerisation (TAP54a vs HP1g) 2. Binary protein-protein interaction (KAP1 and HP1) 3. Different subnuclear domaines (macroH2A vs H2A.BBD)

26 Protein oligomerisation (TAP54a vs HP1g)
TAP54a (RuvB-like 1) was shown to exist in oligomers The heterochromatin proteins HP1 (a, b, g) are also known to oligomerise But HP1 and Tap54 do not interact PentaHis-HRP Streptavidin-HRP NS 1 2 3 4 1 2 3 4 1 - BAP.Tap54a+BirA.Tap54a 2 - BAP.Tap54a+BirA.HP1g 3 - BAP.HP1g+BirA.Tap54a 4 - BAP. HP1g+BirA. HP1g BAP-TAP54a 51 51 NS 39 39 28 28 BAP-HP1g Two BAP fusions (HP1 and Tap54) coexpressed with one Bira fusion (HP1 or Tap54) PentaHis-HRP Streptavidin-HRP 1 2 3 1 2 3 1 - control 2 - BAP.Tap54a + BAP.HP1g + BirA.Tap54a 3 - BAP.Tap54a + BAP.HP1g + BirA.HP1g NS BAP-TAP54a NS BAP-HP1g NS

27 Binary protein-protein interaction (HP1 and Kap1)
BAP.HP1g + BirA.Kap1 system PentaHis-HRP Streptavidin-HRP 1 - BAP.HP1g+BirA.wtKap1 2 - BAP. HP1g+BirA.mutKap1 3 - BAP.GFP+BirA.wtKap1 4 - BAP. GFP+BirA.mutKap1 1 2 3 4 1 2 3 4 NS BAP-GFP BAP-HP1 BAP.Kap1 + BirA.HP1g system 1 2 3 4 5 6 7 8 PentaHis-HRP BAP-KAP1 1,3,5,7 - BAP.wtKap1 2,4,6,8 - BAP.mutKap1 Streptavidin-HRP BAP-KAP1 - Competitor - Biotin + KAP1wt + KAP1mut

28 A B C - + - + - - + - + + + - - - - + + + - + - - + - + + + - -
a-His-HRP Streptavidin-HRP B a-His-HRP Streptavidin-HRP 1 2 3 4 5 6 7 8 1 2 3 4 5 6 7 8 NS NS BAP-TAP54a BAP-GFP NS BAP-HP1g BAP-HP1 BirA-TAP54 BirA-KAP1BDwt BirA-HP1 BirA-KAP1BDMut BAP-TAP54 BAP-HP1 BAP-HP1 BAP-GFP 1 2 3 4 5 6 NS 1 2 3 4 5 6 7 8 a-His-HRP BAP-KAP1 BAP-TAP54a NS BAP-HP1g NS Streptavidin-HRP BAP-KAP1 BirA-TAP54 BirA-HP1 BAP-TAP54 - - Biotin + KAP1wt + KAP1mut Competitor BAP-HP1 C aHis-HRP Streptavidin-HRP 1 2 3 4 BirA-GFP BirA-PCNA BAP-H3.1 BAP-CenpA Expt1 Expt2 0.2 0.4 0.6 0.8 H3.1 CenpA BirA: PCNA/GFP BAP: BirA-PCNA + BAP-H3.1 BirA-PCNA + BAP-CenpA Biotin DIC

29 Can use stable isotopes
Proximity-Utilizing-Biotinylation (PUB) for study interactions between known interaction partners Advantage of PUB Possibility to use mass spectrometry instead of western blotting to detect biotinylation Can use multiplexing Can use stable isotopes

30 Structure of different types of BAD domains
1 2 3 4 % of biotinylation 100% 50% H2Az B BAD Linear region Interaction strength BAD BAD1070: M G H H H H H H H G L T R I L E A Q K I V R G G L E BAD1118: M G H H H H H H H G L T R I L E A Q K I F R G G L E BAD1135: M G H H H H H H H G L T R I L E A Q K I Y R G G L E trypsin 30

31 MRM of ions with m/z 648 and 563 BAD1070 Biotinylated BAD1070
Propionylated B I L E A Q K I V R P I L E A Q K I V R N-terminus С-terminus N-terminus С-terminus Р B BAD 1070 BAD 1070 b-seria y-seria

32 MRM of ions with m/z 672 (BAD1118) and 680 (BAD1135)
Biotinylated BAD1135 Biotinylated 1185.7 B B I L E A Q K I F R I L E A Q K I Y R H2A.BirA + H2AZ.BAD Streptavidin-HRP Anti-His-HRP 1 2 3 1 2 3 1 2 3 1 2 3 1 2 3 Ubi-b-H2AZ Ubi-b-H2AZ b-H2AZ b-H2AZ Input FlowThrough Elution FlowThrough 32 Elution

33 a b c d e Figure 3 BAP1070 BAP1118 BAP1135 Experimental scheme
I L E A Q K(Pr) I V R y8 y7 b2 b3 y6 b4 y4 b6 y3 b7 y2 b8 y5 Intens. +MS2(563.2), 6.2min 0.0 1.0 7 x10 400 600 800 1000 m/z 200 I L E A Q K(Biot) I V R y8++ y6++ +MS2(648.8), 6.6min 2.0 5 AGAATCCTGGAAGCTCAGAAGATCGTGAGAGGAGGCCTCGAG… R I L E A Q K I V R G G L E AGAATCCTGGAAGCTCAGAAGATCTTCAGAGGAGGCCTCGAG… R I L E A Q K I F R G G L E AGAATCCTGGAAGCTCAGAAGATCTACAGAGGAGGCCTCGAG… R I L E A Q K I Y R G G L E BAP1070 BAP1118 BAP1135 c Experimental scheme CMV.H2Az.BAP1070 a. 4hr biotin pulse before harvest c. Incubation on Ni2+-NTA agarose CMV.H2Az.BAP1118 pOz.H2A.BirA b. Mix 3 samples c. Wash, ON trypsin and LC-MS/MS CMV.H2Az.BAP1135 d e M In FT El In FT El BAP1070 propionylated MS2(563.2) BAP1070 biotinylated MS2(648.8) Ub-H2AZ BAP1118 propionylated H2AZ MS2(587.2) BAP1118 biotinylated MS2(672.8) Coomassie Blue Streptavidin-HRP BAP1135 propionylated MS2(623.3) Ni-NTA purification BAP1135 biotinylated MS2(708.4) Figure 3 2 4 6 8 10 12 Time [min]

34 Identification of Light and Heavy peptides
HEAVY propionylated peptide from BAD1070 LIGHT biotinylated y6 y4 y3 y2 b7 b8 y5 HEAVY propionylated y7 LIGHT propionylated peptide from BAD1070 LIGHT Propionylated 10’ biotin pulse y6 y5 y3 b8 y2 b7 y4

35 Analysis of a specific sub-population of BAP-fusion
BirA-POLH + BAP-PCNA 5 min biotin 48 hr 6 hr UV 20 J/m2 Streptavidin pulldown FT Elu C 1 2 3 4 5 6 7 8 9 10 PCNA BAP-PCNA Ub-BAP-PCNA BirA-GFP BirA-POLHwt Bir-AGFP FT Elu B UT 1 2 3 4 5 6XHis-HRP + + + + + + - + - + UV Ub-BAP-PCNA BAP-PCNA BirA-GFP BirA-PolHwt BirA-POLHΔΔ aPCNA + + - - - BirA-POLHwt - - + - - BirA-POLHΔΔ - - - + - BirA-POLH.PIP BirA-POLH.UBZ - - - - + BAP-PCNA + - + + + BAP-PCNAmut - + - - -

36 Proximity Utilizing Biotinylation (PUB) &
3- PUB-NChIP Proximity Utilizing Biotinylation (PUB) & Native Chromatin Immunoprecipitation (NChIP) Current Approaches to Study Histone PTMs in Proximity to DNA Damage & Repair Classic ChIP using DDR implicated chromatin protein Crosslinking is necessary Protein part is damaged NChIP using α-Histone PTM No need to crosslink use the DNA-histone interactions Any DNA could be damaged PUB-NChIP In Vivo biotinylation approach to study chromatin in proximity of a protein of interest

37 Proximity Utilizing Biotinylation (PUB)
3- PUB-NChIP Proximity Utilizing Biotinylation (PUB) Biotin Y X BirA BAP Y BAP X BirA BirA: Biotin Ligase BAP: Biotin Accepting Peptide Add His tag too in the vectors Kulyyassov A, Shoaib M, et al. J Proteome Res Sep 2 BAP.Histone (Biotinylated) BirA.X Biotin BAP.Histone Cotransfection with .. Biotinylated chromatin can be purified PUB-NChIP Histone

38 Rad18 Proximal Chromatin is Specifically Biotinylated
3- PUB-NChIP PUB-nChIP Rad18 Proximal Chromatin is Specifically Biotinylated BirA.Rad18 + BAP.H2A HEK – 293T cells 6 h after UVC (20 J/m2) 15 min Biotin Pulse BirA-Rad18 BAP-H3.1 BAP-H2A - + αHis-HRP Streptavidin HRP biotin αRad18 combined αH2A biotin combined BirA: Biotin Ligase BAP: Biotin Accepting Peptide

39 Chromatin Purification in PUB-NChIP Micrococcal Nuclease Digestion
MNase Supernatant Pellet Input Flowthrough Elution EthBr Staining 300 bp 500 bp 200 bp Mono Di Tri 15 min Biotin Pulse before harvesting Harvest cells and prepare Nuclei Micrococcal Nuclease Digestion WB: Streptavidin-HRP BAP.H2A 12 kDa 30 kDa 0.4 M salt extraction of nucleosomes Coomassie Blue Staining 12 kDa 20 kDa BAP.H2A H3 H2B H2A H4 + Streptavidin 3h binding of nucleosomes in Sepharose-Streptavidin beads Elution of Biotinylated H2A along with other histones

40 Chromatin Purified by PUB-NChIP is Enriched in Expected PTMs
γH2AX biotin combined BirA-RAD18 BAP-H2A + 3 h after Ionizing Radiation (10 Gy) 15 min Biotin Pulse HEK 293T cells α -H3 α - γH2AX BirA-RAD18 BirA-HP1α BAP-H2A + - + + BirA-HP1α

41 3- PUB-NChIP PUB-nChIP PUB-NChIP Reveals a Specific Pattern of H4 Acetylation in Rad18 Proximal Chromatin BirA.GFP BAP.H2A L H BirA.Rad18 1 : 1 1 2 SILAC Experimental Design HEK-293T cells BirA.GFP cotransfected with BAP.H2A control Biotinylates everything GFP Biotin BirA.GFP + BAP.H2A HEK 293T cells 1Ac 2Ac 3Ac 4Ac UM H/L ratios MS analysis of Histone H4 peptide 4-17 (GKGGKGLGKGGAKR) 1- GFP+H2A (H) / GFP+H2A (L) 2- Rad18+H2A (H) / GFP+H2A (L)

42 3- PUB-NChIP PUB-nChIP Proximity of Biotinylated Chromatin with Rad18 is Diminished after 6h Chase HEK – 293T cells BirA.Rad18 + BAP.H2A 6h after UVC (20 J/m2) 15 min Biotin Pulse Fixed 6h later CHASE SAMPLE Fixed Immediately PULSE Sample Pulse Biotin Overlap Rad18 Pulse Chase BAP.H3 BAP.H2A 25kDa α6XHis-HRP Streptavidin-HRP BirA.Rad18 Chase Zoom Biotin Overlap Rad18

43 harvested immediately
3- PUB-NChIP Rad18 Specific Pattern Changes after Proximity with Rad18 is Diminished HEK-293T cells BirA.GFP BAP.H2A L H BirA.Rad18 1 : 1 1 2 4 SILAC Experimental Design UVC: 20 J/m2 15 min Biotin Pulse after 6 h of UVC Chase samples, Biotin was removed, cells washed, reincubated in normal medium, harvested after 6h Pulse samples, Biotin was removed, cells washed and harvested immediately 3 Pulse Samples Chase samples H/L ratios MS analysis of Histone H4 peptide 4-17 (GKGGKGLGKGGAKR) UM 1Ac 2Ac 3Ac 4Ac 1 0.6 0.2 1.4 1- GFP+H2A (H) / GFP+H2A (L) 2- Rad18+H2A (H) / GFP+H2A (L) 3- GFP+H2A (H) / GFP+H2A (L) 4- Rad18+H2A (H) / GFP+H2A (L) Pulse Chase

44 PUB-NChIP to Study Alternative Chromatin States
BAP-H2ABBD BAP-MacroH2A BAP-H2AZ BirA-Rad18 + Combined αRad18 streptavidin HEK – 293T cells 6 h after UVC (20 J/m2) 15 min Biotin Pulse Streptavidin HRP BirA-Rad18 BAP-H2ABBD BAP-mH2A BAP-H2AZ BAP-H2AZub Merge with DNA wud be more helpful in supporting the claim that mH2A biotinylation pattern is in DNA dense regions

45 MS analysis of Histone H4 peptide 4-17 (GKGGKGLGKGGAKR)
3- PUB-NChIP Pattern of H4 Acetylation near Rad18 is Different in H2AZ Containing Chromatin HEK-293T cells BirA.GFP BAP.H2A L H BirA.Rad18 BAP.H2AZ 1 : 1 1 2 3 4 SILAC Experimental Design UVC: 20 J/m2 15 min Biotin Pulse after 6h of UVC UM 1Ac 2Ac 3Ac 4Ac H/L ratios 1- GFP+H2A (H) / GFP+H2A (L) 2- Rad18+H2A (H) / GFP+H2A (L) 3- GFP+H2AZ (H) / GFP+H2A (L) 4- Rad18+H2AZ (H) / GFP+H2A (L) MS analysis of Histone H4 peptide 4-17 (GKGGKGLGKGGAKR) H2A H2AZ

46 Tumor heterogeneity requires Single-Cell analysis
Cellular variability Heritable Nonheritable Genetic Epigenetic Stochasticity at the level of individual cells Parkhomchuk D et al. Use of high throughput sequencing to observe genome dynamics at a single cell level. Proc Natl Acad Sci U S A Dec 8;106(49): Position Type G A C T H6 The statistics of distances between successive mutations in experimental samples is compared with simulated random mutations. R1(49) R2(17) R3(24) VMR (Fano factor) – variance to mean ratio H3(81) H4(80) H6(54) H5(83) H1(41) H2(31) H2 0.6 1.0 1.4 1.8

47 Use of PUB to study epigenetic variability
PUB allows to study the protein of interest at defined time after the interaction took place Pulse labeling with biotin BirA-Emerin + BAP-H2A BirA-Nurim + BAP-H2A Emerin-GFP Nurim-GFP biotin A GFP biotin GFP Biotin GFP DAPI B Pulse – chase setup: Cells are labeled with biotin for 5’, then washed and allowed to enter mitosis The chromatin domains that were proximal to nuclear envelope in the interphase appear as discrete bands on mitotic chromosomes

48 Acknowledgements Group members: Collaborators: Undine Mechold
Martine Comisso Antoine Viens Shoaib Muhammad Evelyne Saade Damien Vertut Arman Kulyyassov Chloe Robin Pasquale Moio Franck Broouillard Patricia Kannouche


Download ppt "Development of proteomics tools to study intranuclear organization"

Similar presentations


Ads by Google