Presentation is loading. Please wait.

Presentation is loading. Please wait.

Development of proteomics tools to study intranuclear organization Vasily Ogryzko Group of “Proteomics & epigenetics’, UMR 8126 CNRS, Institut Gustave.

Similar presentations


Presentation on theme: "Development of proteomics tools to study intranuclear organization Vasily Ogryzko Group of “Proteomics & epigenetics’, UMR 8126 CNRS, Institut Gustave."— Presentation transcript:

1 Development of proteomics tools to study intranuclear organization Vasily Ogryzko Group of “Proteomics & epigenetics’, UMR 8126 CNRS, Institut Gustave Roussy 15 мая 2014 Программа визитов иностранных учёных в российские научные центры фонда "Династия"

2 Importance of proteomics One genome Two proteomes

3 Proteins: Structure Levels Proteomics: High throughput Study of proteins Questions: Amounts Localization Modifications Interactions Methodology : 2D electrophoresis Mass spectrometry Epitope tagging

4 Decipher mechanisms of epigenetic regulation (histone code, other self-perpetuating protein modifications) Predict function of newly discovered genes (protein-protein interaction partners) can be addressed by proteomics Challenges of postgenomic era: Study post-transcriptional steps in gene regulation (microRNA, etc)

5 Research Units (IRCIV) Clinical Research Division (DRC) Hospital ActivitiesResearch Division Healthcare - Research - Education International Scientific Advisory Board

6 Platforms Jean-Yves Scoazec Imaging / flow cytometry Animal facility Integrated biology Translational research Tumor collection Biotherapies Bioinformatics Research Division Eric Solary Scientific Policy Committee Clinical Research Gilles Vassal Steering Committee Research Units Eric Solary Research Coordination and Management Service / Logistics Service Steering Committee Technology Transfert Company

7 Integrated Biology Proteomics platform Lipidomics platform Metabolomics platform Functional genomics platform Bioinformatics platform Biological resources center Proteomics platform at IGR

8 Vasily OGRYZKO – DR2, INSERM Emilie COCHET – Technicienne, IGR Alain DEROUSSENT – IR, CNRS Geographic location: IGR, PR2, room 355 Personnel:

9 Main instrument: Nano-HPLC/CHIP/ion-trap (Agilent) + Agilent off-gel separator for preanalytic fractionation + Small laboratory equipment Proteomics platform at IGR

10 1. Protein footprinting: motivation Epigenetic information can be encoded in macromolecular interactions Proteins are much more interesting objects than DNA or RNA, i.e. not only their amounts but their conformation and interaction plays essential role

11 Protein footprinting: motivation Biological system as: Chemical reactorMechanical device Concentrations (quantities) are all what we need Quantities will tell us nothing

12 Proteome footprinting: motivation Comparing only protein amounts between proteomes might be looking at the tip of the iceberg 1. Chemical reactor versus machine 2. Differences in protein amounts do not show immediately in many cases, unlike changes in conformations or interactions Need to develop quantitative approaches to monitor changes in protein surfaces in vivo

13 Protein/proteome footprinting: the principle Goals: 1. Monitor surface of a particular protein in vivo 2. Detect changes in protein surfaces on proteome-wide basis Protein Isolated Interacting Modification Identification of modified site ProteaseMass spec

14 Lysine containing peptide: mono-, di- and trimethylation by DMS 1methyl2methyl3methyl 14

15 Arginine containing peptide: mono- and dimethylation by DMS 14 1methyl2methyl

16 Stable isotope DMSD6 produces a mass shift 17 instead of CD3 CH3

17 Discrimination between in vitro and in vivo methylation using stable isotopes KCH3 KCD3 KCH3

18 Footprinting of H2AZ expressed in bacteria Total spectra ,

19 Footprinting of H2AZ expressed in bacteria TTSHGRHLQLAIRATIAGGGVIPHIHK

20 CH3 +CD3 Footprinting of H2AZ/H2B dimer in vitro

21 DMS DMSD6 Trypsin, (affinity enrichment) LC-MS/MS Denaturation A B … Ctrl DMS coomassie …

22 Conclusions 1. DMS methylates proteins in vivo Methodology: 2. Use of stable isotope DMSD6 allows to set up a quantitative approach to monitor reactivity of residues in vivo and in vitro 3. H2AZ and H2B surfaces change after forming H2AZ/H2B dimer

23 2. New proteomics-based strategy to study protein-protein interactions in vivo Proximity-Utilizing-Biotinylation (PUB)

24 3. LC-MS/MS Analysis of ratio Biotinylated/propionylated peptides Biotinilated propionilated I Retention time ( min ) 2. Purification of all HisTag proteins On Ni agarose beads, propionic anhydride treatment, trypsin digest B BAD Р 24 Biotin ligase (wild type) Biotin Accepting Domain (Short peptide with HisTag) B Biotin residue P Propionyl residue wtBirA BAD 1.Interaction between protein A and B causes biotin transfer and its covalent binding to Lysine of BAD Protein А Protein В B BAD wtBirA Proximity-Utilizing-Biotinylation (PUB) for study interactions between known interaction partners

25 Biotinylation levels are interaction dependent 1. Protein oligomerisation (TAP54  vs HP1  ) 2. Binary protein-protein interaction (KAP1 and HP1) 3. Different subnuclear domaines (macroH2A vs H2A.BBD)

26 PentaHis-HRPStreptavidin-HRP Protein oligomerisation (TAP54  vs HP1  ) BAP-TAP54  NS BAP-HP1  NS 1 - BAP.Tap54  +BirA.Tap54  2 - BAP.Tap54a+BirA.HP1  3 - BAP.HP1  +BirA.Tap54  4 - BAP. HP1  +BirA. HP1  BAP-TAP54  123 NS BAP-HP1  NS 123 PentaHis-HRPStreptavidin-HRP 1 - control 2 - BAP.Tap54  + BAP.HP1  + BirA.Tap54  3 - BAP.Tap54  + BAP.HP1  + BirA.HP1  1.TAP54  (RuvB-like 1) was shown to exist in oligomers 2.The heterochromatin proteins HP1 ( , ,  ) are also known to oligomerise 3.But HP1 and Tap54 do not interact Two BAP fusions (HP1 and Tap54) coexpressed with one Bira fusion (HP1 or Tap54)

27 PentaHis-HRPStreptavidin-HRP Binary protein-protein interaction (HP1 and Kap1) PentaHis-HRP Streptavidin-HRP BAP-HP1 BAP-GFP 1234 NS BAP.HP1  +BirA.wtKap1 2 - BAP. HP1  +BirA.mutKap1 3 - BAP.GFP+BirA.wtKap1 4 - BAP. GFP+BirA.mutKap1 BAP-KAP1 - Biotin + KAP1wt + KAP1mut Competitor BAP-KAP BAP.HP1  + BirA.Kap1 system BAP.Kap1 + BirA.HP1  system 1,3,5,7 - BAP.wtKap1 2,4,6,8 - BAP.mutKap1

28 A BAP-TAP54   -His-HRP Streptavidin-HRP  -His-HRP Streptavidin-HRP BAP-HP1 BAP-GFP B BAP-TAP54  BAP-KAP1  -His-HRP Streptavidin-HRP - Biotin + KAP1wt + KAP1mut Competitor BAP-KAP NS BAP-HP1  NS - + DICBiotin BirA-PCNA + BAP-H3.1 BirA-PCNA + BAP-CenpA C BirA-TAP54 BirA-HP1 BAP-TAP54 BAP-HP BirA-TAP54 BirA-HP1 BAP-TAP54 BAP-HP BirA-KAP1BDwt BirA-KAP1BDMut BAP-GFP BAP-HP  His-HRP Streptavidin-HRP 1234 BirA-GFP BirA-PCNA BAP-H3.1 BAP-CenpA BAP-H3.1 BAP-CenpA BAP-H3.1 BAP-CenpA Expt1Expt H3.1CenpAH3.1CenpA BirA: PCNA/GFP BAP:

29 Proximity-Utilizing-Biotinylation (PUB) for study interactions between known interaction partners Advantage of PUB Possibility to use mass spectrometry instead of western blotting to detect biotinylation  Can use multiplexing  Can use stable isotopes

30 30 Structure of different types of BAD domains BAD1070: M G H H H H H H H G L T R I L E A Q K I V R G G L E BAD1118: M G H H H H H H H G L T R I L E A Q K I F R G G L E BAD1135: M G H H H H H H H G L T R I L E A Q K I Y R G G L E BAD trypsin H2Az B BAD Interaction strength % of biotinylation 100% 50% Linear region

31 BAD1070 Biotinylated b-seria y-seria B I L E A Q K I V R BAD1070 Propionylated P I L E A Q K I V R N-terminusС-terminus B BAD 1070 Р N-terminusС-terminus MRM of ions with m/z 648 and 563

32 32 B I L E A Q K I F R BAD1118 Biotinylated B I L E A Q K I Y R BAD1135 Biotinylated MRM of ions with m/z 672 (BAD1118) and 680 (BAD1135) H2A.BirA + H2AZ.BAD InputFlowThroughElution b-H2AZ Ubi-b-H2AZ FlowThroughElution b-H2AZ Ubi-b-H2AZ Anti-His-HRPStreptavidin-HRP

33 Figure 3 d Coomassie BlueStreptavidin-HRP InFTElInFTElM H2AZ Ub-H2AZ Ni-NTA purification AGAATCCTGGAAGCTCAGAAGATCGTGAGAGGAGGCCTCGAG… R I L E A Q K I V R G G L E AGAATCCTGGAAGCTCAGAAGATCTTCAGAGGAGGCCTCGAG… R I L E A Q K I F R G G L E AGAATCCTGGAAGCTCAGAAGATCTACAGAGGAGGCCTCGAG… R I L E A Q K I Y R G G L E BAP1070 BAP1118 BAP1135 Experimental scheme pOz.H2A.BirA c. Incubation on Ni 2+ -NTA agarose CMV.H2Az.BAP1070 CMV.H2Az.BAP1118 CMV.H2Az.BAP1135 a. 4hr biotin pulse before harvest b. Mix 3 samples c. Wash, ON trypsin and LC- MS/MS MS2(623.3) MS2(708.4) Time [min] MS2(563.2) MS2(648.8) MS2(587.2) MS2(672.8) BAP1070 propionylated BAP1070 biotinylated BAP1118 propionylated BAP1118 biotinylated BAP1135 propionylated BAP1135 biotinylated I L E A Q K(Pr) I V R y8y8 y7y7 b2b2 b3b3 y6y6 b4b4 y4y4 b6b6 y3y3 b7b7 y2y2 b8b8 y5y5 Intens. b7b7 y7y7 b8b8 y8y8 y6y6 b6b6 y5y5 y4y4 b4b4 b2b2 y3y3 y2y2 +MS2(563.2), 6.2min x m/z b3b3 200 I L E A Q K(Biot) I V R y8y8 y7y7 b2b2 b3b3 y6y6 b4b4 y4y4 b6b6 y3y3 b7b7 y2y2 b8b8 y5y5 b7b7 y7y7 b8b8 y8y8 y6y6 b6b6 y5y5 y4y4 b4b4 b2b2 y3y3 y2y2 y 8 ++ y MS2(648.8), 6.6min x10 Intens m/z b3b3 200 a b c e

34 LIGHT propionylated peptide from BAD1070 HEAVY propionylated peptide from BAD1070 HEAVY propionylated LIGHT Propionylated 10’ biotin pulse LIGHT biotinylated y7y7 y7y7 y6y6 y6y6 y5y5 y5y5 y4y4 y4y4 y3y3 y3y3 y2y2 y2y2 b8b8 b8b8 b7b7 b7b7 Identification of Light and Heavy peptides

35 BAP-PCNA Ub-BAP-PCNA BirA-GFP BirA-PolHwt BirA-POLHΔΔ UV BirA-POLHΔΔ BirA-POLH.UBZ BirA-POLH.PIP BirA-POLHwt  PCNA  6XHis-HRP BirA-POLH + BAP-PCNA 5 min biotin 48 hr6 hr UV 20 J/m 2 Streptavidin pulldown FT Elu A C PCNA BAP-PCNA Ub-BAP-PCNA BirA-GFP BirA-POLHwt Bir-AGFP BirA-POLHwt FTElu B UT BAP-PCNA BAP-PCNAmut Analysis of a specific sub-population of BAP-fusion

36 Proximity Utilizing Biotinylation (PUB) & Native Chromatin Immunoprecipitation (NChIP) 3- PUB-NChIP NChIP using α-Histone PTM No need to crosslink use the DNA-histone interactions Any DNA could be damaged Current Approaches to Study Histone PTMs in Proximity to DNA Damage & Repair Classic ChIP using DDR implicated chromatin protein Crosslinking is necessary Protein part is damaged PUB-NChIP In Vivo biotinylation approach to study chromatin in proximity of a protein of interest

37 Y BAP X BirA BirA: Biotin Ligase BAP: Biotin Accepting Peptide Biotin 3- PUB-NChIP Proximity Utilizing Biotinylation (PUB) Kulyyassov A, Shoaib M, et al. J Proteome Res Sep 2 Y X X BirA Y BAP BAP.Histone (Biotinylated) BirA.X Biotin BAP.Histone BirA.X Cotransfection with.. Biotinylated chromatin can be purified PUB-NChIP.. Histone

38 BirA-Rad18 BAP-H3.1 BAP-H2A αHis-HRP Streptavidin HRP Rad18 Proximal Chromatin is Specifically Biotinylated PUB-nChIP 38/50 αH2A biotin combined biotin αRad18 combined BirA.Rad18 + BAP.H2A HEK – 293T cells 6 h after UVC (20 J/m 2 ) 15 min Biotin Pulse 3- PUB-NChIP BirA: Biotin Ligase BAP: Biotin Accepting Peptide

39 Coomassie Blue Staining 12 kDa 20 kDa BAP.H2A H3 H2B H2A H4 + Streptavidin MNaseSupernatant PelletInput FlowthroughElution EthBr Staining 300 bp 500 bp 200 bp Mono Di Tri WB: Streptavidin-HRP BAP.H2A 12 kDa 30 kDa Chromatin Purification in PUB-NChIP PUB-nChIP 39/50 3- PUB-NChIP 15 min Biotin Pulse before harvesting Harvest cells and prepare Nuclei Micrococcal Nuclease Digestion 0.4 M salt extraction of nucleosomes 3h binding of nucleosomes in Sepharose-Streptavidin beads Elution of Biotinylated H2A along with other histones

40 BirA-HP1α α -H3 α - γH2AX BirA-RAD18 BirA-HP1α BAP-H2A γH2AXbiotincombined BirA-RAD18 BAP-H2A + 3 h after Ionizing Radiation (10 Gy) 15 min Biotin Pulse HEK 293T cells PUB-nChIP 40/50 3- PUB-NChIP Chromatin Purified by PUB-NChIP is Enriched in Expected PTMs

41 PUB-nChIP PUB-NChIP Reveals a Specific Pattern of H4 Acetylation in Rad18 Proximal Chromatin 41/50 1Ac2Ac3Ac4Ac UM H/L ratios MS analysis of Histone H4 peptide 4-17 (GKGGKGLGKGGAKR) 1- GFP+H2A (H) / GFP+H2A (L) 2- Rad18+H2A (H) / GFP+H2A (L) H/L ratios PUB-NChIP BirA.GFP cotransfected with BAP.H2A control Biotinylates everything GFPBiotin BirA.GFP + BAP.H2A HEK 293T cells BirA.GFP BAP.H2A L BirA.GFP BAP.H2A H BirA.Rad18 BAP.H2A H 1 : SILAC Experimental Design HEK-293T cells

42 PUB-nChIP Proximity of Biotinylated Chromatin with Rad18 is Diminished after 6h Chase 42/50 3- PUB-NChIP Chase Zoom BiotinOverlapRad18 Pulse Biotin Overlap Rad18 Pulse Chase BAP.H3BAP.H2A 25kDa α6XHis-HRP Streptavidin-HRP 25kDa BirA.Rad18 Pulse Chase HEK – 293T cells BirA.Rad18 + BAP.H2A 6h after UVC (20 J/m 2 ) 15 min Biotin Pulse Fixed 6h later CHASE SAMPLE Fixed Immediately PULSE Sample

43 Rad18 Specific Pattern Changes after Proximity with Rad18 is Diminished H/L ratios MS analysis of Histone H4 peptide 4-17 (GKGGKGLGKGGAKR) UM 1Ac2Ac3Ac4Ac GFP+H2A (H) / GFP+H2A (L) 2- Rad18+H2A (H) / GFP+H2A (L) 3- GFP+H2A (H) / GFP+H2A (L) 4- Rad18+H2A (H) / GFP+H2A (L) Pulse Chase 3- PUB-NChIP HEK-293T cells BirA.GFP BAP.H2A L BirA.GFP BAP.H2A H BirA.Rad18 BAP.H2A H BirA.Rad18 BAP.H2A H BirA.GFP BAP.H2A H 1 : SILAC Experimental Design UVC: 20 J/m 2 15 min Biotin Pulse after 6 h of UVC Chase samples, Biotin was removed, cells washed, reincubated in normal medium, harvested after 6h Pulse samples, Biotin was removed, cells washed and harvested immediately 1 : 1 3 Pulse Samples Chase samples

44 PUB-NChIP to Study Alternative Chromatin States Streptavidin HRP BirA-Rad18 BAP-H2ABBD BAP-mH2A BAP-H2ABBD BirA-Rad18 BAP-H2AZ BAP-H2AZ BAP-H2AZub Streptavidin HRP 3- PUB-NChIP BAP-H2ABBD BAP-MacroH2A BAP-H2AZ BirA-Rad18 + CombinedαRad18streptavidin HEK – 293T cells 6 h after UVC (20 J/m 2 ) 15 min Biotin Pulse

45 Pattern of H4 Acetylation near Rad18 is Different in H2AZ Containing Chromatin 3- PUB-NChIP UM 1Ac2Ac3Ac4Ac H/L ratios 1- GFP+ H2A (H) / GFP+H2A (L) 2- Rad18+ H2A (H) / GFP+H2A (L) 3- GFP+ H2AZ (H) / GFP+H2A (L) 4- Rad18+ H2AZ (H) / GFP+H2A (L) MS analysis of Histone H4 peptide 4-17 (GKGGKGLGKGGAKR) H2A H2AZ HEK-293T cells BirA.GFP BAP.H2A L BirA.GFP BAP.H2A H BirA.Rad18 BAP.H2A H BirA.Rad18 BAP.H2AZ H BirA.GFP BAP.H2AZ H 1 : SILAC Experimental Design UVC: 20 J/m 2 15 min Biotin Pulse after 6h of UVC

46 H6 H2 R1(49)R2(17)R3(24) H3(81)H4(80)H5(83) H1(41) H6(54) H2(31) VMR (Fano factor) – variance to mean ratio The statistics of distances between successive mutations in experimental samples is compared with simulated random mutations. Parkhomchuk D et al. Use of high throughput sequencing to observe genome dynamics at a single cell level. Proc Natl Acad Sci U S A Dec 8;106(49): Cellular variability HeritableNonheritable EpigeneticGenetic Stochasticity at the level of individual cells Tumor heterogeneity requires Single-Cell analysis PositionType G  A C  T G  A C  T

47 PUB allows to study the protein of interest at defined time after the interaction took place Emerin-GFP Nurim-GFP BirA-Emerin + BAP-H2A BirA-Nurim + BAP-H2A DAPI biotin GFP The chromatin domains that were proximal to nuclear envelope in the interphase appear as discrete bands on mitotic chromosomes Pulse labeling with biotin Pulse – chase setup: Cells are labeled with biotin for 5’, then washed and allowed to enter mitosis A B Biotin GFP Use of PUB to study epigenetic variability

48 Acknowledgements Undine Mechold Martine Comisso Antoine Viens Shoaib Muhammad Evelyne Saade Damien Vertut Arman Kulyyassov Chloe Robin Group members: Collaborators: Pasquale Moio Franck Broouillard Patricia Kannouche


Download ppt "Development of proteomics tools to study intranuclear organization Vasily Ogryzko Group of “Proteomics & epigenetics’, UMR 8126 CNRS, Institut Gustave."

Similar presentations


Ads by Google