Presentation is loading. Please wait.

Presentation is loading. Please wait.

Section H Cloning Vectors Molecular Biology Course.

Similar presentations


Presentation on theme: "Section H Cloning Vectors Molecular Biology Course."— Presentation transcript:

1

2 Section H Cloning Vectors Molecular Biology Course

3 vectors Cloning vectors: to clone a gene in a vector Expression vectors: allowing the exogenous DNA to be inserted, stored, and manipulated mainly at DNA level Integration vectors: allowing the exogenous DNA to be inserted, stored, and expressed. Introduction

4 Cloning vectors H1 Plasmid vecters H2 Bacteriophage vectors H3 Cosmids and YACs H4 Eukaryotic vectors

5 H1 Design of Plasmid Vectors H1-1 A plasmid vector for cloning H1-2 A plasmid vector for gene expression Cloning vectors

6 1.autonomously replicating independent of host’s genome. 2.Easily to be isolated from the host cell. (Plasmid preparation) 3.Selective markers: Selection of cells (1) Containing vector: one marker is enough (2) Containing ligation products: # twin antibiotic resistance # blue-white screening 4.Contains a multiple cloning site (MCS) H1-1 A plasmid vector for cloning H1 Design of Plasmid Vectors

7 Ampicillin resistant? yes yes Tetracycline resistant? No yes B X B B B X Amp r ori Amp r Tc r ori pBR322 Amp r Tc r ori Screening by insertional inactivation of a resistance gene

8 Replica plating: transfer of the colonies from one plate to another using absorbent pad or Velvet ( 绒布 ). transfer of colonies +ampicillin + tetracycline these colonies have bacteria with recombinant plasmid H1 Design of Plasmid Vectors

9

10 Blue white screening Amp r ori pUC18 (3 kb) MCS (Multiple cloning sites, 多科隆位点) Lac promoter lacZ’ Screening by insertional inactivation of the lacZ gene The insertion of a DNA fragment interrupts the ORF of lacZ’ gene, resulting in non-functional gene product that can not digest its substrate x- gal. H1 Design of Plasmid Vectors

11 lacZ encode enzyme b-galactosidase lacZ’: a shortened derivative of lacZ, encoding N-terminal a-peptide of b-galactosidase. Host strain for vectors containing lacZ’: contains a mutant gene encoding only the C- terminal portion of b-galactosidase which can then complement the a-peptide to produce the active enzyme IPTG X-gal (substrate of the enzyme) lac promoter  Blue product The expression of active b-galactosidase has to be vector dependent for the selection purpose H1 Design of Plasmid Vectors

12 Recreated vector: blue transformants Recombinant plasmid: containing inserted DNA: white transformants Recreated vector (no insert) Recombinant plasmid (co nt ain insert) H1 Design of Plasmid Vectors

13 Multiple cloning sites Multiple restriction sites enable the convenient insertion of target DNA into a vector Amp r ori pUC18 (3 kb) MCS (Multiple cloning sites, 多科隆位点) Lac promoter lacZ’ …ACGAATTCGAGCTCGGTACCCGGGGATCCTCTAGAGTCGACCTGCAGGCATGCA…. T h rA s n S er S e r Val Pro Gly Asp Pro Leu Glu Ser Thr Cys Arg His Ala Ser… EcoRISacIKpnI SmaI XmaI BamHI XbaI SalI HincII AccI PstISphI Lac Z H1 Design of Plasmid Vectors

14 H1-2 A plasmid vector for gene expression Expression vectors: allowing the exogenous DNA to be inserted, stored and expressed. 1.Promoter and terminator for RNA transcription are required. 2.Intact ORF and ribosomal binding sites (RBS) are required for translation. H1 Design of Plasmid Vectors

15 Some cloning vector can be used to transcribe a gene. (pUC vectors) Special transcriptional vectors: pGEM series containing promoters from bacteriophages T7 and SP6 for in vitro transcription with the corresponding polymerases. Expression vector (transcription & translation). H1 Design of Plasmid Vectors

16 Amp r ori pUC18 (3 kb) MCS (Multiple cloning sites, 多科隆位点) Lac promoter lacZ’ 1.The ORF of the inserted gene has to be in the same direction as that of the lacZ 2.A fusion protein contains the N- terminal sequence of lacZ and the inserted ORF will be produced H1 Design of Plasmid Vectors

17 Expression vector (transcription & translation). Promoters 1.lacUV-5: a mutant lac promoter which is independent of cAMP receptor protein. (constitutive expression) 2.lP L promoter 3.Phage T7 promoter Fused proteins Individual proteins H1 Design of Plasmid Vectors

18 T7 promoter RBS Start codon MCS Transcriptio n terminator Amp r ori T7 expression vector H1 Design of Plasmid Vectors

19 Fused proteins Lac fusions: (discussed) His-tag fusions: A sequence encodes His-tag was inserted at the N- terminus of the target ORF, which allows purification of the fusion protein to be purified by binding to Ni 2+ column. H1 Design of Plasmid Vectors

20 H2 Bacteriophage vector Tow examples: H2-1 λ phage bacteriophageλ λ replacement vector H2-2 M13 phage M13 phage vector Cloning in M13 Hybrid plasmid-M13 vectors Cloning vectors

21 viruses that can infect bacteria kb in length Linear or circular genome (cos ends) λ phage Lytic phase (Replicate and release) Lysogenic phase (integrate into host genome) H2 Bacteriophage vector

22 DNA Protein coat cos Nonessential region Long (left) arm short (right) arm Exogenous DNA (~20-23 kb) H2-1λ phage H2 Bacteriophage vector

23 5‘-CGGGGCGGCGACCTCG-3’ 3’-GCCCCGCCGCTGGAGC-5’ Cleavage Ligation (during packaging) (after infection) GGGCGGGCGACCTCG-3’ 5’-CG + GC-5’ 3’-GCCCCGCCGCTGGA The phage λ cos ends Circular form Linear form H2 Bacteriophage vector

24 λ phage H2 Bacteriophage vector

25 λ replacement vector Replace the nonessential region of the phage genome with exogenous DNA (~ 20 kb) high transformation efficiency (1000-time higher than plasmid) H2 Bacteriophage vector

26 λ replacement vector 2. Packing with a mixture of the phage coat proteins and phage DNA- processing enzymes 1.Ligation 3. Infection and formation of plaques H2 Bacteriophage vector

27 Plaques: the clear areas within the lawn where lysis and re-infection have prevented the cells from growing. Recombinant DNA may be purified from phage particles from plaques or from liquid culture. H2 Bacteriophage vector

28 Genes or foreign sequences may be incorporated essentially permanently into the genome of E.coli by integration of a vector containing the sequence of interest. lysogens in cloning techniques H2 Bacteriophage vector

29 A filamentous phage Phage particles contain a 6.7kb circular single strand of DNA. After infection of a sensitive E.coli host,the complementary strand is synthesized,and the DNA replicated as a double-stranded circle,the replicative form(RF) with about 100 copies per cell. Contrasting to phage,the cell are not lysed by M13,but continue to grow slowly,and single- stranded forms are continuously packaged and released from the cells as new phage particles. H2-2 M13 phage H2 Bacteriophage vector

30 M13 phage vectors 1. Replication form (RF, dsDNA) of M13 phage can be purified and manipulated like a plamid. 2.Phage particles (ssDNA): DNA can be isolated in a single-stranded form DNA sequencing (Topic J2) Site-directed mutagenesis (Topic J5) Cloning (RF, like plasmid)  transfection (recombinant DNA)  growth (plating on a cell lawn)  plaques formation (slow growth) H2 Bacteriophage vector

31 Blue-white selection

32 Small plasmid vectors (pBluescript) being developed to incorporate M13 functionality Contain both the plasmid and M13 origin of replication Normally propagate as true plasmids Can be induced to form single-stranded phage particles by infection of the host cell with a helper phage. Hybrid plasmid-M13 vectors H2 Bacteriophage vector

33 H3 Cosmids and YACs H3-1 Cloning large DNA fragments ( > 20 kb) H3-2 Cosmid vectors H3-3 YAC vectors H3-4 Selection in S. cerevisiae ( 啤 酒酵母) Cloning vectors

34 Analysis of eukaryotic genes and the genome organization of eukaryotes requires vectors with a larger capacity for cloned DNA than plasmids or phage. Human genome (3 x 10 9 bp): large genome and large gene demand vectors with a large size capacity. H3-1 Cloning large DNA fragments (Eukaryotic Genome project) H3 Cosmids and YACs

35 H3-2 Cosmid vectors 1.Utilizing the properties of the phage l cos sites in a plasmid vector. 2.A combination of the plasmid vector and the COS site which allows the target DNA to be inserted into the l head. 3.The insert can be kb. H3 Cosmids and YACs

36 Digestion Ligation C) Packaging and infect Formation of a cosmid clone

37 Cloning in a cosmid vector cos B SmaI B B S S cos B B H3 Cosmids and YACs

38 Essential components of YAC vectors : Centromers (CEN), telomeres (TEL) and autonomous replicating sequence (ARS) for proliferation in the host cell. amp r for selective amplification and markers such as TRP1 and URA3 for identifying cells containing the YAC vector in yeast cells. Recognition sites of restriction enzymes (e.g., EcoRI and BamHI) H3-3YAC vectors Can accommodate genomic DNA fragments of more than 1 Mb, and can be used to clone the entire human genome, but not good in mapping and analysis H3 Cosmids and YACs

39 Yeast selection H3 Cosmids and YACs

40 Cloning in YAC vector insertion site for red-white selection SUP4 : CEN4 ARS TRP1 TEL B B TEL SnaB Digest with BamHI/SnaI Ligate with blunt ends Transfect into yeast H3 Cosmids and YACs

41 1.Saccharomyces cerevisiae selectable markers do not confer resistance to toxic substances 2.Growth of yeast on selective media lacking specific nutrients can serve for selection. Auxotrophic yeast mutants ( 营养缺欠型 ) are made as host strains for plasmids containing the genes complementary to the growth defect. For example: TRP1 mutants can’t make tryptophan, and can only grow on media supplemented with tryptophan. The presence of a plasmid containing gene encoding tryptophane enables the cell to grow on media without tryptophan. H3-4 Selection in S.cerevisiae H3 Cosmids and YACs

42 H4 Eukaryotic Vectors Transfection of eukarotic cells Shuttle vectors H4-1 Yeast episomal plasmids (Yeasts) H4-2 Agrobacterium tumefaciens ( 农杆菌 ) Ti plasmid (Plants) H4-3 Baculovirus (Insects) H4-4 Mammalian viral vectors (Mammalian) Cloning vectors

43 The take-up of DNA into eukaryotic cells Transfection: 1. more problematic than bacterial transformation 2.Much lower efficiency in the progress 3.Transfection methods Electroporation Microinjection liposome H4 Eukaryotic Vectors

44 Shuttle vectors Vectors contain sequences required for replication and selection in both E. coli and the desired host cells, so that the construction and many other manipulation of the recombinant plasmids can be completed in E. coli. Most of the eukaryotic vectors are constructed as shuttle vectors H4 Eukaryotic Vectors

45 MCS A Shuttle vector H4 Eukaryotic Vectors

46 H4-1 Yeast episomal plasmids (YEps) Vectors for the cloning and expression of genes in Saccharomyces cerevisiae. 1.Based on 2 micron (2m) plasmid which is 6 kb in length. One origin Two genes involved in replication A site-specific recombination protein FLP, homologous to l Int. 2.Normally replicate as plasmids, and may integrate into the yeast genome. H4 Eukaryotic Vectors

47 Insert Figure 1 MCS A YEp vector H4 Eukaryotic Vectors

48 Replicate as plasmid from 2m origin integrate by recombinantion YEp vector H4 Eukaryotic Vectors

49 H4-2 Agrobacterium tumefaciens Ti plasmid Ti plasmid 200kb T-DNA plant chromosome Integrated T-DNA Gene induce crown gall H4 Eukaryotic Vectors

50 crown gall or tumor H4 Eukaryotic Vectors

51 Recombinant Ti plasmid 1.Place the target gene in the T-DNA region of a Ti plasmid, then transform the recombinant Ti plasmid. (WT is not good because of the crown gall formation) 2.Recombinant T-DNA transformed into the A. tumefaciens cell carrying a modified Ti plasmid without T-DNA (T-DNA that are responsible for crown gall formation. The deleted T-DNA is called disarmed T-DNA shuttle vector). H4 Eukaryotic Vectors

52 Plant gene engineering using T-DNA vector H4 Eukaryotic Vectors

53 H4-3 Baculovirus 1.Infects insect cells 2.The strong promoter expressing polyhedrin protein can be used to over- express foreign genes engineered. Thus, large quantities of proteins can be produced in infected insect cells. 3.Insect expression system is an important eukaryotic expression system. H4 Eukaryotic Vectors

54 H4-4 Mammalian viral vectors 1.SV40: 5.2 kb, can pack DNA fragment similar to phage l. 2. Retroviruss: single-stranded RNA genome, which copy to dsDNA after infection. Have some strong promoters for gene expression Gene therapy H4 Eukaryotic Vectors

55 Gene transfer Genes may be transiently or permanently introduced into cultured eukaryotic cells without the use of vector in strict sense. Transient expression Integration H4 Eukaryotic Vectors


Download ppt "Section H Cloning Vectors Molecular Biology Course."

Similar presentations


Ads by Google