Presentation is loading. Please wait.

Presentation is loading. Please wait.

HBV/HIV co-infections: molecular and biological characterization of occult HBV strains or strains resistant to antiviral treatment ANRS N°12149 Selma de.

Similar presentations


Presentation on theme: "HBV/HIV co-infections: molecular and biological characterization of occult HBV strains or strains resistant to antiviral treatment ANRS N°12149 Selma de."— Presentation transcript:

1 HBV/HIV co-infections: molecular and biological characterization of occult HBV strains or strains resistant to antiviral treatment ANRS N°12149 Selma de ANDRADE GOMES Lab. de Virologia Molecular IOC-FIOCRUZ Alan KAY Centre de Recherche en Cancérologie de Lyon (INSERM U1052) ANRS/Programa Nacional DST/AIDS Evaluation Meeting, Rio de Janeiro, 4-5 April 2011

2 History of the collaboration In the early 2000s, our laboratory in Lyon was actively working on the problem of occult Hepatitis B Virus (HBV) infections:  Chemin, I., Zoulim, F., Merle, P., Arkhis, A., Chevallier, M., Kay, A., Cova, L., Chevallier, P., Mandrand, B., Trepo, C., High incidence of hepatitis B infections among chronic hepatitis cases of unknown aetiology. J Hepatol 34,  Chemin, I., Jeantet, D., Kay, A., Trepo, C., Role of silent hepatitis B virus in chronic hepatitis B surface antigen(-) liver disease. Antiviral Res 52,  Jeantet, D., Chemin, I., Mandrand, B., Zoulim, F., Trepo, C., Kay, A., Characterization of two hepatitis B virus populations isolated from a hepatitis B surface antigen-negative patient. Hepatology 35, In Rio de Janeiro at the same time, Selma GOMES was also working on occult HBV infections, and more specifically in HIV co-infected patients:  Gomes, S.A., Yoshida, C.F., Niel, C., Detection of hepatitis B virus DNA in hepatitis B surface antigen-negative serum by polymerase chain reaction: evaluation of different primer pairs and conditions. Acta Virol 40,  Santos, E.A., Yoshida, C.F., Rolla, V.C., Mendes, J.M., Vieira, I.F., Arabe, J., Gomes, S.A., Frequent occult hepatitis B virus infection in patients infected with human immunodeficiency virus type 1. Eur J Clin Microbiol Infect Dis 22,  Santos, E.A., Sucupira, M.V., Arabe, J., Gomes, S.A., Hepatitis B virus variants in an HIV-HBV co-infected patient at different periods of antiretroviral treatment with and without lamivudine. BMC Infect Dis 4, 29 Selma contacted our laboratory, and I visited Selma’s lab in 2005 We decided to apply for an INSERM/FIOCRUZ exchange agreement

3  8%:High 2-7%:Intermediate < 2%:Low 350 million chronic HBV patients350 million chronic HBV patients > 10 times the number of HIV patients> 10 times the number of HIV patients HBV infection Brazil – Intermediate to high

4 ADAD A2 D F/H A D F/H A D A1 F2 D CBCB A1 D A2 D CBCB EDAEDA DADA FADFAD Pujol and Devesa (2005) J Clin Gastroenterol. 39: Geographic distribution of HBV genotypes

5 What is occult HBV infection? HBV DNA Acute infection: rapid loss (<6 months) of surface antigen (HBsAg) and HBV DNA Chronic infection: persistence (>6 months) of HBsAg, persistence of HBV DNA Occult HBV infection: detectable HBV DNA, HBsAg undetectable  DNA levels usually very low (<1000 copies/ml)  the virus can be transmitted  retains the oncogenic potential of chronic HBV infections

6 Occult HBV infection in the literature over years over years Number of publications Raimondo et al, J Hepatol 2008 Chemin & Trepo J Clin Virol 2005, Adapted

7 Raimondo et al, J Hepaol 2007, modified StudyCountryN° patients Occult HBV N° (%) Hofer, 1998 Torres-Baranda, 2006 Filippini, 2006 Mphahlele, 2006 Pogany, 2005 Neau, 2005 Santos, 2003 Wagner, 2004 Goncales, 2003 Nunez, 2002 Piroth, 2000 Raffa, 2007 Switzerland Mexico Italy South Africa Netherlands France Brazil France Brazil Spain France Italy (89%) 7 (20%) 17 (20%) 31 (22.%) 4 (4%) 1 (0.6%) 11 (37%) 16 (16%) 8 (5%) 0 13 (35%) 42 (41%) Methods “nested” PCR (serial evaluation) “nested” PCR “nested” PCR (liver) single step PCR Cobas Amplicor HBV Monitor (Roche) single step PCR Cobas Amplicor HBV Monitor (Roche) Occult HBV and HIV co-infection

8 A new tool for amplifying full-length HBV genomes by completion and ligation of HBV RC-DNA to cccDNA Rolling circle amplification (RCA) In Vitro Complementation and Ligation HBV ccc-DNA DR1 DR2 DR1 DR2 T4 DNA polymerase + T4 DNA ligase d. HBV RC-DNA Hybridization minus-strand primers Elongation minus-strand DNA Strand Displacement Hybridization plus-strand primers End product – High molecular weight double-stranded DNA

9 Illustration of RCA 3 kb M H 2 O Copies / reaction 10 kb 3 kb HBV genome (3.2 kb) Agarose gel of RCA products Southern blot of gel – HBV has been succesfully amplified Unit-length HBV genomes can be excised from RCA products – can be dirctly cloned and/or sequenced Sensitivity can be increased by doing A genomic PCR on RCA products

10 Applications 1) Reactivation of an occult HBV infection in a HIV+ patient  Patient HIV+, anti-HBc+, anti-HBs+ - profile resolved acute HBV infection?  Reactivated occult HBV infection after glucocorticoid treatment  Amplified, cloned and sequenced full-length HBV genomes after RCA  Genomes are of subgenotype A2 (European genotype A)  No drug resistance mutations despite poor compliance of patient  Genomes viable – replication competent, secrete viral particles  What causes immune-escape from anti-HBs? ● all genomes contain 2 significant mutations in the S gene ● K122R – very rare in genotype A ● D144E – potential immune-escape mutant

11 HBsAg C- C+ P K122/D144K122R/D144K122/D144EK122R/D144E C- = Normal human serum C+ = Serum from a vaccinated person P = Patient’s serum What can the patient’s serum recognize?  Genetically engineered genomes so that they express viral particles of wild-type HBsAg sequence, with K122R, D144E or both  Transfected into cells, labeled with 35 S-Met/Cys, immuno-precipitated secreted viral particles Acute Infection < 6 Mo Emergence of K122R. Low-level HBV replication HIV+ Wild-type Virus K122/D144 HIV+ Occult Infection > 12 Yrs Glucocorticoid treatment 6 Mo 1 Mo Stimulation of HBV replication. Emergence of D144E HIV+ Reactivation 2 Mo K122R/D144E HIV+ Antiviral treatment Seroconversion to  -HBe HBV- HIV+

12 Applications 2) Mutations associated with HBeAg-negativity in subgenotype F2 prevalent in Brazil  HBeAg-negative mutants – important global health problem  Stop codon position 28 of precore region - not possible for genotype A or F2  Anna KRAMVIS – subgenotype A1 – mutations in core promoter/precore region AGGCACATGTGTGGATG TATTCTA PrecoreHBcAg Genotype A Subgenotype F2 Core promoter HBV RC-DNA DR1 DR Spe I RCA Spe I 1762 Full-length HBV genome

13 H20H20 HBV full-legth genome RCA cut Spe I RCA then genomic PCR using primers at Spe I site Amplification and sequencing of genotype F genomes #1 GGGGGAGGAGATTAGGTTAAAGGTCTTTGTATT//CCAGCACCATGCAA//CCCACTGTT//CTTTGGGGCATGGAC #2 GGGGGAGGAGATTAGGTTAAAGGTCTTTGTATT//CCAGCACCATGCAA//CCCACTGTT//CTTTGGGGCATGGAC #3 GGGKGAGGAGASTAGGTTAATGGTTTATGTATT//CCAGCACCATGCAA//CCCACTGTT//CTTTGGGACATGGAC #4 GGGKGAGGAGASTAGGTTAATGGTTTATGTATT//CCAGCACCATGCAA//CCCACTGTT//CTTTGGGACATGGAC F2 GGGGGAGGAGATTAGGTTAAAGGTCTTTGTATT//CCAGCACCATGCAA//CCCACTGTT//CTTTGGGGCATGGAC PrecoreHBcAg  Subtype F2 genomes do not show the mutations found with subtype A1  Some isolates (#3 & 4) have A1762T but not G1764A  Isolates #3 & 4 have other mutations before and after 1762/1764  Also have mutated codon 29 (GGC  GAC, Glycine  Tyrosine)  More work needed (sequence complete genomes, study HBeAg expression)

14 HBV-HIV co-infection HIV interferes with the natural history of HBV infection by enhancing HBV replication, leading to more severe liver disease, decreasing hepatitis B ‘e’ antigen seroconversion and increasing HBV DNA levels Due to the shared modes of transmission of HBV and HIV, the prevalence of HBV infected patients is higher than in non-HIV infected individuals Occult HBV infection = Detection of HBV DNA in absence of HBsAg Possible explanations: Low rate of HBV replication, mutations that inhibit HBsAg expression or change HBsAg antigenicity, thus preventing detection by commercial assays. Among HIV-infected cohorts, occult HBV infection prevalence is widely divergent, ranging from 0% to 89%. Jeantet et al., 2002

15 Patient characteristics Years n = 91 Years n = 33 Year 2006 n=43 Year 2009 n=144 Sex Male Female 80 (88%) 11(12%) 21 (64%) 12(36%) 35 (81%) 8 (19%) 59 (41%) 85 (59%) Age (years) < >49 2 (3%) 21 (29.5%) 32 (45%) 16 (22.5%) 3 (10%) 16 (51.5%) 8 (25.5%) 4 (13%) 0 (0%) 7 (16.5%) 19 (45.5%) 16 (38%) 24 (19%) 42 (33.3%) 40 (31.7%) 20 (16%) Antiretroviral treatment Yes No 26 (31%) 58(69%) 26 (78%) 7 (22%) 39 (90%) 4 (10%) 105 (82%) 23 (18%) Lamivudine Yes No 33 (36%) 58 (64%) 23 (70%) 10(30%) 37 (95%) 2 (5%) 103 (80%) 25 (20%) TDF Yes0010 (23%040 (30%) HBV markers Anti-HBc total87 (97%)26 (81%)39 (91%)23 (16%) Anti-HBc only34/89 (38%)8/30 (26%)11/42 (26%)4/144 (3%) Anti-HBs/Anti-HBc53 (59.5)18 (60%)28 (66.5%)19 (13.5%) Anti-HBs only2/89 (2%)1/32 (3%)3/42 (7%)37/144 (28%) No HBV serological marker03/32 (3%)084/144 (58%) HBV DNA Pre S or S region05 (5.5%)06 (18%)06 (14%)05 (3.3%) Demographical and serological data of HIV positive/ HBsAg negative patients HBsAg >10% ( ), 2%

16 PatientSexYear Antiretroviral treatment LAM/TVFAnti-HBs/Anti-HBc HBV loads (copies/mL) Genotypes S STOP CODONS Other mutations GM1998YN/NPos/Pos10 4 A/A1S36- P36F2006YY/NPos/Pos10 6 A/A1S216Y100C PF1999N-Pos/Pos10 4 A/A1S187- P51M2006YY/NNeg/Pos10 4 A/A1NoY100C,*E164D 21967M2009NN/NNeg/PosNDA/A1NoQ101H F134L HM1997YN/NPos/Pos10 4 A/A1No P65M2006N-Pos/Pos10 4 A/A2No 23818F2009YY/NNeg/NegNDA/A2No SM2003YN/NPos/Pos10 2 DNoT118V, A128V EM1999YY/NPos/Pos10 6 DNoS136Y pcDNA3 HindIII EcoRV pre-S2S S HindIIIEcoRV HindIII Transfection of eukariotic cells (CHO or HUH7) BIOELISA HBsAg Colour (Biokit) Serological and molecular features of HBV isolates from cases of occult infection * LAM triple mutation

17 Expression of HBsAg containing Y100C variant frequently detected in occult HBV infection

18 Conclusions/Perspectives Ongoing studies at IPEC-Fiocruz should confirm or not the recent decrease of HBV prevalence in the HIV infected Brazilian population, observed by us. Ongoing studies at IPEC-Fiocruz should confirm or not the recent decrease of HBV prevalence in the HIV infected Brazilian population, observed by us. Drug resistance: In agreement with dr. Couto-Fernandez (member of National Network for HIV Genotyping Lab. AIDS, IOC) we had designed a doctoral thesis to study the lamivudine and tenofovir resistance mutations of both HIV and HBV (populations and subpopulations by pyrosequencing) in cases of co- infectin. Unfortunately, the collaboration did not happen. We are inviting co- infected patients from IPEC to initiate this study. Drug resistance: In agreement with dr. Couto-Fernandez (member of National Network for HIV Genotyping Lab. AIDS, IOC) we had designed a doctoral thesis to study the lamivudine and tenofovir resistance mutations of both HIV and HBV (populations and subpopulations by pyrosequencing) in cases of co- infectin. Unfortunately, the collaboration did not happen. We are inviting co- infected patients from IPEC to initiate this study. Regiã Pol HIV

19 Studies of occult HBV infection in the sera and PBMC of HIV co-infected patients will also be carried out in France Studies of occult HBV infection in the sera and PBMC of HIV co-infected patients will also be carried out in France Future studies are needed to monitor transmission of HBV isolates from cases of occult infections/drug resistance Future studies are needed to monitor transmission of HBV isolates from cases of occult infections/drug resistance The most appropriate therapy for a particular genotype or a mutation type may be identified by in vitro phenotyping Test: Transfection of complete genomes into human cells in the presence of drugs The most appropriate therapy for a particular genotype or a mutation type may be identified by in vitro phenotyping Test: Transfection of complete genomes into human cells in the presence of drugs The study of mutations affecting HBeAg expression in Brazilian-specific genotypes/subtypes will also be continued The study of mutations affecting HBeAg expression in Brazilian-specific genotypes/subtypes will also be continued Conclusions/Perspectives

20 Publications Mello, Francisco C. A. ; Martel, Nora ; Gomes, Selma A. ; Araujo, Natalia M..Expression of Hepatitis B Virus Surface Antigen Containing Y100C Variant Frequently Detected in Occult HBV Infection. Hepatitis Research and Treatment, v. 2011, p. 1-4, Araujo, N. M. ; Branco-Vieira M ; Silva ACM ; Pilotto JH ; Grinsztejn B ; Trepo C; Gomes, SA. Occult hepatitis B virus infection in HIV-infected patients:Evaluation of biochemical, virological and molecular parameters.. Hepatology Research, v. 38, p , 2008 Araujo NM, Waizbort R, Kay A. Hepatitis B Virus infection from an evolutionary point of view: how viral, host, and environmental factors shape genotypes and subgenotypes. Infectious, Genetics and Evolution, (under revision) 2 other papers in preparation 1 Brazilian patent deposited 1 thesis in co-tutelle Instituo Oswaldo Cruz/Université Claude Bernard Lyon 1 Valorization of the project (1)

21 Valorization of the project (2) A mini-symposium organized by Selma GOMES: “International Conferences and Debates on Relevant Aspects of Viral Hepatitis” IOC-FIOCRUZ, Rio de Janeiro, Brazil, February 26ty 2010 Participants: Selma GOMES, IOC-FIOCRUZ, Brazil: Introduction Anna KRAMVIS, Witwatersrand University, Johannesburg, South Africa: Phylogeny of Hepatitis B Virus Stephen Locarnini, Victoria Infectious Diseases Reference Laboratory, Melbourne, Australia: Drug resistance of Hepatitis B Virus Christoph COMBET, IBCP, Lyon, France: Hepatitis C virus genomic variability Alan Kay, INSERM U871, Lyon, France:Cell-culture models for HBV infectivityulture models for HBV infectivity Nora MARTEL PhD student, ANRS doctoral bursary Joint thesis IOC/UCBL1 Caroline SOARES Exchanges Natalia ARAUJO Lyon  Rio de Janeiro Rio de Janeiro  Lyon

22 Brazilian team Brazilian team Researcher Researcher Dr. Natalia M. Araujo Dr. Natalia M. Araujo PHD students PHD students Kelly C. Pereira Kelly C. Pereira French team Researchers/clinicians Researchers/clinicians Dr Isabelle Chemin Dr Isabelle Chemin Pr. Christian Trepo Pr. Christian Trepo Dr. Laurent Cotte Dr. Laurent Cotte Dr. Sophie Allain (Limoges Dr. Sophie Allain (Limoges PHD student PHD student Nora Martel Nora Martel Collaborators (cohort of patients) IPEC/Fiocruz (Dr.Beatriz Grinsztejn, Dr.Juçara Arabe Other Financial Support Brazil: CNPq/ France/Brazil: INSERM/FIOCRUZ Research team/ Acknowledgment


Download ppt "HBV/HIV co-infections: molecular and biological characterization of occult HBV strains or strains resistant to antiviral treatment ANRS N°12149 Selma de."

Similar presentations


Ads by Google