Presentation is loading. Please wait.

Presentation is loading. Please wait.

BFPdCas9 PB-LTR TRE VP64 2A PB-LTR BFPdCas9 PB-LTR VP64 TRE 2A PB-LTR BFPdCas9 PB-LTR VP64 TRE VP64 2A PB-LTR PL-A1 PL-A2 PL-A3 Supplementary Figure 1.

Similar presentations


Presentation on theme: "BFPdCas9 PB-LTR TRE VP64 2A PB-LTR BFPdCas9 PB-LTR VP64 TRE 2A PB-LTR BFPdCas9 PB-LTR VP64 TRE VP64 2A PB-LTR PL-A1 PL-A2 PL-A3 Supplementary Figure 1."— Presentation transcript:

1 BFPdCas9 PB-LTR TRE VP64 2A PB-LTR BFPdCas9 PB-LTR VP64 TRE 2A PB-LTR BFPdCas9 PB-LTR VP64 TRE VP64 2A PB-LTR PL-A1 PL-A2 PL-A3 Supplementary Figure 1 Luciferase reading Site ….TCACAGCTCGGGACCAGGCTAGGGCACATCTGTTTCAAGCTAGTTCTAAGAAGACTTGGGACTTCAGACA………146-bp………………… CAAGGTTGGTATTGAATACAGACAGGACTGCTGGGCTGCAGGCATACTTGAACTGTGGTGGAGAGTGCTGTCTAGGCCTTAGAGGCTG GCCCTGGGAGGAACTGGGTGTGGGGAGGTTGTAGCCCGACCCTGCCCCTCCCCCCAGGGAGGTTGAGAGTTCTGGGCAGACGGCAG ATGCATAACAAAGGTGCATGATAGCTCTGCCCTGGGGGCAGAGAAGATGGTTGGGGAGGGGTCCCTCTCGTCCTAGCCCTTCCTTAATC TGCTATTGAGGAAGCTTTGTGAACTTGGCGGCTTCCAAGTCGCTGCCTTTATTTAGGTCTTCCAACTAA… g 2TALE 2 Overlap g 3-1 TALE 3 g 4 TALE 4 Overlap A B D E g 3-2 g 3-3 g 1TALE 1 Overlap dCas9 PB-LTR HA TRE HA PB-LTR C …TCTTCCAGAGTCAGAGGCAGACGGGTCTCCAGTAGTTCGAGGCCAGCCTGGTCTACAGCGTGAGTTCCA………548-bp…………. …GTCAAGGCCACCATAGCCTTAAGTTTACCCCAAGTTCTACAAAGGTTTGGTACAGGGCGCACAGCTCCGGGTCAAAGGAGTCTGCTTA GGAGACGGCGATGGATCCCTCCCCAACCCCCATTCCTGTCCTGCCTCTTTAGTGTCTTTGAGAGTCTCTGGTGAAAGATCCGAGCGAAG AGGTGGCTGGTAGCCAAAAGGCAGGCTTGCTACATTCCTTATCCAGGGAAGCGGTTTGAATAGGGAGGAGGGCGTCTAGATGC…… g 2TALE 2 Overlap g 6 g 4 g 5 g 3 g 1 TALE 1 Overlap Relative enrichment F

2 PB-TRE-cMyc-2A-Klf4-2A-Sox2 (CKS) (9.6kb) PB-TRE-TALE-A-mCherry (9.0kb) PB-TRE-dCas9-As-BFP (~10.5kb) PB-gRNAs-EF1a-mCherry-2A-rt-TA (8.6kb) ++ + PB-CAG-rt-TA (7.1kb) + TALE-As transfectiondCas9-As transfection PB-TRE-cMyc-2A-Klf4-2A-Sox2 (CKS) Supplementary Figure 2 A MEF Electroporation Plasmids Relative gene expression CKS+ B Site Relative GCKS expression C Luciferase reading Site D

3 Supplementary Figure 3 A Relative enrichment Day H3K27ac Relative enrichment p300 B Day

4 Supplementary Figure 4 Relative GCKS expression Relative LRH1 expression Site A B

5 Supplementary figure 5 5kb enhancer

6 Position 1 Position 2 Position 3 NINNHDNG 11’22’33’44’55’ 66’ NC VP64 2A-mCherry TRE bpA PB- 3’LTR PB-5’LTR Picking TALE Repeat Clones Plasmid extraction Insert digestion & purification Insert ligation Transformation Clone picking Overnight 1 hr 3 hr Genotyping 2 hr Work Flow Supplementary figure 6 A G C T A

7 B C D GFP Phase


Download ppt "BFPdCas9 PB-LTR TRE VP64 2A PB-LTR BFPdCas9 PB-LTR VP64 TRE 2A PB-LTR BFPdCas9 PB-LTR VP64 TRE VP64 2A PB-LTR PL-A1 PL-A2 PL-A3 Supplementary Figure 1."

Similar presentations


Ads by Google