Presentation is loading. Please wait.

Presentation is loading. Please wait.

Cancer results from mutations in genes regulating cell growth Two classes of genes are involved: 1) - positive regulators promote cancer by hyperactivity.

Similar presentations


Presentation on theme: "Cancer results from mutations in genes regulating cell growth Two classes of genes are involved: 1) - positive regulators promote cancer by hyperactivity."— Presentation transcript:

1 Cancer results from mutations in genes regulating cell growth Two classes of genes are involved: 1) - positive regulators promote cancer by hyperactivity (one allele is enough) 2) - negative regulators, promote cancer by loss of activity (two allele must be mutated) Oncogenes Suppressor genes

2 The first tumor suppressor- (retinoblastoma) The most frequent mutated tumor suppressor - p53 was first cloned at the weizmann institute and is mutated in > 50% of all cancer. 25,000 papers published on p53 in 22 years How p53 functions as a tumor suppressor? Rb p53

3

4

5

6

7 Parental M1 M1-p53Val135 clones at 32 o C Induction of cell death by active p53

8 Activation of temperature sensitive p53 prevents transformation ts p53 in mutant conformation ts p53 in wild type conformation Myc + Ras + no p53temperature sensitive p53

9 Protein-protein interactions, Transcriptional repression apotosis Negative regulation of DNA binding

10 (Ko LJ & Prives C, Genes & Dev. 10: , 1996) Most of p53 mutations are found in the conserved regions of the central DNA binding domain

11 (Cho Y et al., Science 265:346-55, 1994)

12 Transactivation Growth arrest Other activities (C terminal = TFIIH binding?) (N terminal = SH3 binding?) Apoptosis Bax, IGF-BP3, Fas, killer/DR5, Noxa, PIG3, p53AIP1, PIDD, Puma p21/Waf1 Activated p53 Other genes etc, etc, etc

13 DNA damage, oncogene activation Functional p53 Growth arrest, apoptosis Loss of p53 function

14 Three Experimental Systems 1. Primary and Secondary Targets of p53 2. Target genes related to apoptosis 3. Comparison of p53 and p73 A chip of 10,000 genes is more than ten thousand northern blots

15 Filter hybridization p21 PCNA LIG1 MDM2

16 Representation of 7000 genes on 1 cm 2 chip

17 DIRECT AND INDIRECT TARGETS CHX INHIBITS PROTEIN SYNTHESIS AND PREVENTS ACTIVATION OF SECONDARY TARGETS

18 Effect of Cycloheximide on H1299 v al 135 Cells

19 3824 Only ˜ 10% of the genes changed expression in all 3 repeats (Coller et al. 2000) Primary p53 target genes in presence of CHX

20 Clustering of 259 genes upregulated without CHX at least three times > 2.5 fold a. 9 genes (false?) b. All 38 primary c. 87% of primary

21 p53 - Upregulated Genes in H1299-Val135 system GENE/ PROTEIN NAME p21waf1 MIC1 - member of TGF-b family MDM2 PCNA GADD45 Mitochondrial Stress 70 (Mortalin2) p57KIP2-CDK inhibitor 1C PIG3-p53 induced gene 3 FAS/APO1 BAX-Bcl2 associated X protein BAK1- Bcl2 antagonist/killer RATIO FUNCTION CELL CYCLE APOPTOSIS

22 P53 - Upregulated Genes in H1299-Val135 system GENE/ PROTEIN NAME DDB2-Nucleotide Excision Repair LIG1 - DNA ligase 1 ERCC5 - DNA Excision Repair related TDG - G/T mismatch DNA Glycosylase RPA1 - Replication Factor A Protein 1 MAPK14 MAP4K5 Activaes Jun N-term Kinase MAP2K1 - MEK1 MYD88 - Myeloid differentiation Retinoic Acid Receptor Beta FKBP4 HOXD3 - Homeobox protein CSPG2 - Chondroitin sulfate proteoglycan RATIO FUNCTION DNA REPAIR KINASE ECM DEVELOP. IMMUNOPHIL. RECEPTOR DEVELOP.

23 p53- DRIVEN APOPTOSIS A different cell line (M1) that undergoes apoptosis by p53 at 32

24 - It plays an essential role during developmental as well as adult stages by allowing tissue remodeling, tissue renewal and maintenance of tissue homeostasis APOPTOSIS : - Apoptosis is a genetically controlled program of cell death, also referred to as cell suicide or Programmed Cell Death (PCD). - It is an evolutionary conserved mechanism. - It ultimately leads to elimination of undesired cells either superfluous or potentially harmful when damaged

25 Pro apop Anti apop

26 APOPTOSIS IN LTR6 CELLS AT 32  C. Sub G1

27 SCATTER PLOTS OF 404 GENES THAT WERE REGULATED BY P53 IN LTR6 CELLS A 2h M1 9h LTR6 12h LTR6 2h M1 2h LTR6 12h M1 2h M1 D C B

28 ABCDEFABCDEF M1 LTR6 M1 LTR6 M1 LTR6 Time (hr) Cell type Control M1 2hr M1 12hr LTR6 2hr Clustering of 404 genes based on expression kinetics at 32  C

29 Kinetics of transcriptional activation Cluster D Cluster ECluster C Relative ratio M

30 ACCESSION NO. X63717 U82987 U00115 U16811 MOUSE ACCESSION NO. AB M83649 U82532 J04953 Z16410 AW X74504 AF Fas/APO-1 cell surface antigen Bcl-2 binding component 3 (bbc3) PUMA Bcl-6 Bak p53 Fas antigen/TNFR6 TNFR18 Gelsolin Btg1 EST=PIG8 (Etoposide induced) T10 mRNA/human sentrin/SUMO-1 Apaf RATIO OF EXPRESSION (12h) HUMAN ACCESSION NO. A X89101 A X04412 X61123 R11732 U83117 AL Apoptosis related genes upregulated by p53 H1299 Val Cells LTR 6 Cells

31 Northern Analysis of LTR6 Cells Apaf-1 mRNA induced at 32  C by ts-p53

32 APAF-1 promoter contains p53 target at -604 RRRCWWGYYY N{0-13 bp} RRRCWWGYYY APAF-1AGACATGTCT GGAGACCCTAGGA cGACAAGCCC BAXtcACAAGTTa G AGACAAGCCT GADD45GAACATGTCT AAGCATGCTg MDM2GGtCAAGTTg GGACAcGTCC bp

33 Others Ab x’sX x’sA Oligo A A A A A A B C D p mut Oligo A: AGACATGTCTGGAGACCCTAGGACGACAAGCCC Oligo B: AGACATGTCT CGACAAGCCC Oligo C: AGACATGTCTGGAGAC CGACAAGCCC Oligo D: AGAaATGTCTGGAGACCCTAGGACGAaAAGCCC p53 Binding to APAF-1 Target by Gel Shift Analysis

34 IAPs Smac Bcl-2 Apoptosis Apaf-1 Caspase-9 Cyt c Bax Apoptotic stimuli /dATP Caspase-3 Cellular targets p53 PUMA

35 p53 family members Comparison of p73 and p53 induced genes

36 Scatter plot

37

38

39 /Cip1

40

41


Download ppt "Cancer results from mutations in genes regulating cell growth Two classes of genes are involved: 1) - positive regulators promote cancer by hyperactivity."

Similar presentations


Ads by Google