Presentation is loading. Please wait.

Presentation is loading. Please wait.

Section J Analysis of cloned DNA Molecular Biology Course.

Similar presentations


Presentation on theme: "Section J Analysis of cloned DNA Molecular Biology Course."— Presentation transcript:

1 Section J Analysis of cloned DNA Molecular Biology Course

2 J1 Characterization of clones J2 Nucleic acid sequencing J3 Polymerase chain reaction J4 Organization of cloned genes J5 Mutagenesis of cloned genes J6 Application of cloning Molecular Biology Course

3 1.Restriction mapping 2.Sequencing (DNA & RNA) 3.Northern and Southern blotting 4.PCR Major Techniques used These Techniques may be used for other purpose as well Analysis of cloned DNA- overview

4 J1 Characterization of clones J1-1 Characterization J1-2 Restriction mapping J2-3 Partial digestion J2-4 Labeling nucleic acid J2-5 Southern and Northern blotting Analysis of cloned DNA

5 J1-1 Characterization Determining various properties of a recombinant DNA molecule, such as size, restriction map, nucleotide sequence, whether containing a gene (transcribed sequence), the position and polarity of any gene. Preparation of pure DNA is the first step of any characterization J1 Characterization of clones

6 Size of DNA fragment cloned Restriction digestion & agarose gel electrophoresis using molecular weight marker insert 0.8 kb 0.5 kb 1.0 kb 1.6 kb 2.0 kb 3.0 kb 4.0 kb 3.5 kb J1 Characterization of clones

7 J1-2 Restriction Mapping Cleavage pattern of the insert DNA by restriction enzymes. Useful in determining the order of multiple fragments (genes). 1. Combinational enzyme digestion 2. Partial digestion J1 Characterization of clones

8 1. Combinational enzyme digestion Nonessential region Long (left) arm short (right) arm phage Sal I: 19 kb, 15 kb, 9 kb HindIII: 21 kb, 11 kb, 7 kb, 4 kb SalI + HindIII: 19 kb, 7 kb, 6 kb, 5 kb, 4 kb, 2 kb S – H – H – S – H – S 19 kb + 2 kb 2 kb + 7 kb + 6 kb + 5 kb + 4 kb 19 kb 9 kb 15 kb J1 Characterization of clones

9 Nonessential region Long (left) arm short (right) arm S S 19 kb 9 kb 15 kb 21 kb H 4 kb 11 kb 7 kb H H Delineate the restriction sites on the DNA J1 Characterization of clones

10 2. Partial digestion 10 kb insert Complete digestion Partial digestion 1 kb 2 kb 3 kb 4 kb 6 kb 7 kb 10 kb X X EtBr Stained agarose gel: Can not delineate the EcoRI sites J1 Characterization of clones

11 10 kb insert * * * * End-labeled radioactive DNA partial digestion Agarose electrophoresis autoradiography 3 kb 4 kb 6 kb 10 kb 3 kb 4 kb 6 kb Delineate the restriction sites by partial digested end-labeled radioactive DNA E E E

12 J1-4 Labeling of DNA or RNA probes End labeling : put the labels at the ends Uniform labeling : put the labels internally radioactive labeling: display and/or magnify the signals by radioactivity Non-radioactive labeling: display and/or magnify the signals by antigen labeling – antibody binding – enzyme binding - substrate application (signal release J1 Characterization of clones

13 End labeling Single stranded DNA/RNA 5’-end labeling: dephosphorylation  polynucleotide kinase (PNK) 3’-end labeling: terminal transferase J1 Characterization of clones

14

15 End labeling Double stranded DNA/RNA Fill in the recessive 3’-ends by DNA polymerase Labeled at both ends G CTTAAp5’ For restriction mapping, cut the DNA with another enzyme 5’pAATTC G J1 Characterization of clones

16 Uniformly labeling of DNA/RNA Nick translation: DNase I to introduce random nicks  DNA polI to remove dNMPs from 3’ to 5’ and add new dNMP including labeled nucleotide at the 3’ ends. Hexanucleotide primered labeling: Denature DNA  add random hexanucleotide primers and DNA pol  synthesis of new strand incorporating labeled nucleotide. J1 Characterization of clones

17 Strand-specific DNA probes: e.g.M13 DNA as template the missing strand can be re- synthesized by incorporating radioactive nulceotides Strand-specific RNA probes: labeled by transcription J1 Characterization of clones

18 J1-5 Southern and Northern blotting DNA on blot RNA on blot 1.Genomic DNA preparation RNA preparation 2.Restriction digestion - 3.Denature with alkali - 4. Agarose gel electrophoresis  5. DNA blotting/transfer and fixation RNA 6. Probe labeling  6. Hybridization (temperature)  7. Signal detection (X-ray film or antibody)  J1 Characterization of clones

19 Southern analysis J1 Characterization of clones

20 Steps of Southern blot J1 Characterization of clones

21 bI1 bI2bI3 bI4 bI5 Northern analysis COB RNAs in S. cerevisiae mRNA Pre-mRNAs

22 Blot typeTargetProbeApplications SouthernDNADNA or RNA mapping genomic clones estimating gene numbers NorthernRNADNA or RNA RNA sizes, abundance, and expression WesternProteinAntibodiesprotein size, abundance J1 Characterization of clones

23 J2 Nucleic acid sequencing J2-1 DNA sequencing J2-2 RNA sequencing J2-3 Sequence databases J2-4 Analysis of sequences J2-5 Genome sequencing projects Analysis and uses of cloned DNA

24 J2-1 DNA sequencing Two main methods: Maxam and Gilbert chemical method the end-labeled DNA is subjected to base- specific cleavage reactions prior to gel separation. Sanger`s enzymic method (  ) the latter uses dideoxynucleotides as chain terminators to produce a ladder of molecules generated by polymerase extension of primer. J2 nucleic acid sequencing

25 Maxam and Gilbert Sanger’s enzymic method J2 nucleic acid sequencing

26 GATCTCG ATCTCGG CH 3 TCTCGA TCTCGA DNA labeled at one end with 32 P DNA labeled at one end with 32 P Base modification Release or displace- ment of reacted bases Release or displace- ment of reacted bases Strand scission Maxam and Gilbert chemical method J2 nucleic acid sequencing

27 32 pGpCpTpGpCpTpApGpGpTpGpCpCpGpApGpC 32 p 32 pGpCpTp 32 pGpCpTpGpCpTpAp 32 pGpCpTpGpCpTpApGp 32 pGpCpTpGpCpTpApGpGpTp 32 pGpCpTpGpCpTpApGpGpTpGpCpCp 32 pGpCpTpGpCpTpApGpGpTpGpCpCpGpAp 32 pGpCpTpGpCpTpApGpGpTpGpCpCpGpApGpC Chain cleavage at guanines Chain cleavage at guanines Maxam-Gilbert sequencing. We methylate guanines with a mild DMS treatment that methylates on average one guanine per DNA strand.Then use piperidine to remove the methylated base and break the DNA strand at the apurinic site. J2 nucleic acid sequencing

28 Sanger sequencing This figure shows the structure of a dideoxynucleotide (notice the H atom attached to the 3' carbon). Also depicted in this figure are the ingredients for a Sanger reaction. Notice the different lengths of labeled strands produced in this reaction. J2 nucleic acid sequencing

29 This figure is a representation of an acrylamide sequencing gel. Notice that the sequence of the strand of DNA complementary to the sequenced strand is 5' to 3' ACGCCCGAGTAGCC CAGATT while the sequence of the sequenced strand, 5' to 3', is AATCTGGGCTACTC GGGCGT. J2 nucleic acid sequencing

30 Automatic sequencer 1.Fluorescence Labeled ddNTP 2. Polymerase catalyzed J2 nucleic acid sequencing

31

32 RNA sequencing It is sometimes necessary to sequence RNA directly, especially to determine the position of modified nucleotides present in, eg, tRNA and rRNA. This is achieved by base-specific cleavage of 5’-end-labeled RNA using RNases (ribonuclease) that cleave 3’ to a particular nucleotide. Partial digestion is required to generate a ladder of cleavage products which are analyzed by PAGE. J2 nucleic acid sequencing

33 RNase T1: cleaves after G RNase U2: after A RNase Phy M: after A and U Bacillus cereus RNase: after U and C J2 nucleic acid sequencing

34 G / P 2 P 2.1 J3/4 P4 P5 P P3’ P7P7 P8P8 P 9 T1 cleaved

35 J2-3 Sequence databases Two largest DNA databases of are EMBL in Europe and Genbank in the USA. Newly determined DNA,RNA and protein sequence are entered into databases.The collections of all known sequences are available for analysis by computer. J2 nucleic acid sequencing

36 Sequence database J2 nucleic acid sequencing genebank

37 Sequence database EMBL J2 nucleic acid sequencing

38 J2-4 Analysis of sequences Using computers and software packages, such as GCG sequence analysis package offered by Univ. of Wisconsin 1. 1.Identify important sequence features such as restriction sites,open reading frames,start and stop codons, as well as potential promoter sites, intron- exon junctions,etc. J2 nucleic acid sequencing

39 ORF #1 ORF #2 Sequence analysis of a cloned DNA sequence revealed some important features J2 nucleic acid sequencing

40 2. compare new sequence with all other known sequences in the databases, which can determine whether related sequences have been obtained before. J2 nucleic acid sequencing

41 J2-5 Genome sequencing projects With the development of automated DNA sequencers and robotic workstations to prepare samples for sequencing,the entire genome sequence of several organisms have been determined. Many phages and viruses Several Bacteria (E. coli, 4 x 10 6 ) Plant (Arabidopsis 6.4 x 10 7, rice) Human 3 x 10 9 J2 nucleic acid sequencing

42 J3 Polymerase chain reaction J3-1 PCR J3-2 The PCR cycle J3-3 Template J3-4 Primers J3-5 Enzymes J3-6 PCR optimization Analysis and uses of cloned DNA

43 J3-1 PCR The polymerase chain reaction(PCR) is to used to amplify a sequence of DNA using a pair of primers each complementary to one end of the the DNA target sequence. J3 Polymerase chain reaction

44 J3-2 The PCR cycle Denaturation: The target DNA (template) is separated into two stands by heating to 95 ℃ Primer annealing: The temperature is reduced to around 55 ℃ to allow the primers to anneal. Polymerization (elongation, extension): The temperature is increased to 72 ℃ for optimal polymerization step which uses up dNTPs and required Mg++. J3 Polymerase chain reaction

45

46 Template Primers Enzymes Fig. Steps of PCR J2 nucleic acid sequencing

47 J3-3 Template Any source of DNA that provides one or more target molecules can in principle be used as a template for PCR Whatever the source of template DNA, PCR can only be applied if some sequence information is known so that primers can be designed. J3 Polymerase chain reaction

48 J3-4 Primers PCR primers need to be about 18 to 30 nt long and have similar G+C contents so that they anneal to their complementary sequences at similar temperatures.They are designed to anneal on opposite strands of the target sequence. Tm=2(a+t)+4(g+c): determine annealing temperature. If the primer is nt, annealing temperature can be Tm  5 o C J3 Polymerase chain reaction

49 Degenerate primers: an oligo pool derived from protein sequence. E.g. His-Phe-Pro-Phe-Met-Lys can generate a primer 5’-CAY TTY CCN TTY ATG AAR Y= Pyrimidine N= any base R= purine J3 Polymerase chain reaction

50 J3-5&6 Enzymes and PCR Optimization The most common is Taq polymerase.It has no 3’ to 5’ proofreading exonuclease activity. Accuracy is low, not good for cloning. We can change the annealing temperature and the Mg++ concentration or carry out nested PCR to optimize PCR. J3 Polymerase chain reaction

51 PCR optimization I.Reverse transcriptase-PCR II.Nested PCR J2 nucleic acid sequencing

52 Fig Nested PCR First round primers First round PCR Second round primers Second round PCR Gene of interest J2 nucleic acid sequencing

53 Reverse transcriptase-PCR AAA(A) n 5‘-Cap mRNA (dT) 12~18 primer anneal 5‘-Cap AAA(A) n 3‘5‘ Reverse transcriptase dNTP 5‘-Cap AAA(A) n 5‘ cDNA:mRNA hybrid Regular PCR Fig RT-PCR J2 nucleic acid sequencing

54 J4 Organiztaion of cloned genes J4-1 Organization J4-2Mapping cDNA on Genomic DNA (where) J4-3 S1 nuclease mapping (5’ and 3’ end) J4-4 Primer extension (5’ end) J4-5 Gel retardation (binding protein) J4-6 DNase I footprinting (protein binding sites) J4-7 Reporter genes (promoter study) Analysis and uses of cloned DNA

55 cDNA clones have defined organization. A run of A residues defines the clone’s 3’- end. There will be a stop codon at its upstream. If the clone is complete, there also will be a start condon. These two codon indicates an ORF. J4-1 Organiztion J4 Organization of cloned genes

56 The presence and polarity of any gene in a genomic clone is not obvious (5’ and 3’ end) It can be determined by mapping and probing experiments To determine: which genomic sequences are present in the mature mRNA transcript The absent sequences are usually introns and sequences upstream of the transcription start site and down stream of the 3’-processing site. Start and stop sites for transcription regulatory sequences. J4 Organization of cloned genes

57 J4-2 Mapping cDNA on genomic DNA The genomic clone is digested on a gel and then subjected to Southern blot using all or part of the cDNA as a probe. Using full length cDNA as probe can show which genomic restriction fragments contain sequences also present in the cDNA Using a probe from one end of a cDNA can show the polarity of the gene in the genomic clone. Some of the restriction sites will be common in both clones but may be different distances apart. These can often help to determine the organization of the genomic clone. J4 Organization of cloned genes

58 J4-3 S1 nuclease mapping determines the precise 5’- and 3’- ends of RNA transcripts. Sequence ladder is required to determine the precise position S1 nuclease is an enzyme which specifically hydrolyses single-stranded RNA or DNA. RNA 5’ DNA 3’ * 5’ 3’ RNA 5’ DNA 3’ 5’ 3’ PAGE Analysis Add S1 nuclease J4 Organization of cloned genes

59 J4-4 Primer extension Determine the 5’ ends of RNA molecules using reverse transcriptase to extend an antisense DNA primer in the 5’ to 3’ direction. Sequence ladder is required to determine the precise position J4 Organization of cloned genes

60 J4-5 Gel retardation Mixing a protein extract with a labeled DNA fragment and running the mixture on a native gel will show the presence of DNA-protein complex as retarded bands on the gel. Labeled free DNA/RNA Protein bound with DNA/RNA J4 Organization of cloned genes

61 DNA bound to two proteins DNA-protein complex Bare DNA Fig Gel retardation A short labeled nucleic acid is mixed with a cell or nuclear extract expected to contain the binding protein. Then, samples of labeled nucleic acid, with and without extract, are run on a gel. The DNA-protein complexes are shown by the presence of slowly migrating bands. J4 Organization of cloned genes

62 J4-6 Dnase I footprinting Identify the actual region of sequence with which the protein interacts. AATAAG 5’ * Sequence ladder is required to determine the precise position J4 Organization of cloned genes

63 Bind protein DNase(mild),then remove protein and denature DNA Fig DNase footprinting The protein protects DNA from attack by DNase. We treat the DNA -protein complex with DNase I under mild conditions, so that an average of only one cut occur per DNA molecule. Electrophoresis, autoradiograph J4 Organization of cloned genes

64 0 1 5 Protein Conc: The three lanes represent DNA that was bound to 0, 1, and 5 units of protein. The lane with no protein shows a regular ladder of fragments. The lane with one unit shows some protection, and the lane with 5 units shows complete protection in the middle. We usually include sequencing reactions performed on the same DNA in parallel lanes, which tells exactly where the protein bound. TCGGAGCAACGCAAACAAACGTGCTTGGTCGGAGCAACGCAAACAAACGTGCTTGG J4 Organization of cloned genes

65 J4-7 Reporter genes To study the function of a control element of a gene (promoter and regulatory elements), reporter genes such as b-galactosidase to “report” the promoter action. J4 Organization of cloned genes

66 J5 Mutagenesis of cloned genes J5-1 Deletion mutagenesis J5-2 Site-directed mutagenesis J5-3 PCR mutagenesis Analysis and uses of cloned DNA

67 J5-1 Deletion mutagenesis In the cDNA clones,it is common to delete progressively from the ends of the coding region to discover with parts of the whole protein have properties. In genomic clones,when the transcription part has been identified,upstream are removed progressively to discover the minimum length of upstream sequence that has promoter and regulatory function. J5 Mutagenesis of cloned genes

68 Exonuclease III S1 or mung bean nuclease Ligation J5 Mutagenesis of cloned genes

69 J5-2 Site-directed mutagenesis Formerly,single-stranded templates prepared using M13 were used,but now PCR techniques are now preferred. J5 Mutagenesis of cloned genes

70 J5-3 PCR mutagenesis Deletion or point mutation J5 Mutagenesis of cloned genes

71 SP6 primer T7 primer Forward mutagenic primer Reverse mutagenic primer First PCR Remove primers Denature and anneal PCR mutagenesis Two separate PCR reactions are performed, one amplifying the 5’-portion of the insert using SP6 and the reverse primer, and the other amplifying the 3’-portion of the insert using the forward and T7 primers. J5 Mutagenesis of cloned genes

72 Extend and do second PCR SP6 primer T7 primer PCR mutagenesis Two separate PCR reactions are performed, one amplifying the 5’-portion of the insert using SP6 and the reverse primer, and the other amplifying the 3’-portion of the insert using the forward and T7 primers. Subclone J5 Mutagenesis of cloned genes

73

74 PCR elongation PCR P(deltaP5abc)construction E1-P5 P5’-E2 exon intron P5abc J5 Mutagenesis of cloned genes

75 J6 Applications of cloning J6-1 Applications J6-2 Recombinant protein J6-3Genetically modified organisms J6-4 DNA fingerprinting J6-5 Medical diagnosis J6-5 Gene therapy Analysis of cloned DNA

76 J6-1 Applications J6 Applications of cloning DNA fingerprinting DNA fingerprinting Genetically Modified Organisms Genetically Modified Organisms Recombinant protein Recombinant protein Gene therapy Gene therapy Medical diagnosis Medical diagnosis CLONING

77 J6-2 Recombinant protein · Prior to the advent of gene cloning, production of protein was to purify them from tissues. Drawbacks: small amounts, viral contamination etc. · Gene cloning has circumvented the listed problems. J6 Applications of cloning

78

79 Prokaryotic expression system can be used to produce eukaryotic proteins, but there are some problems: Only cDNA clones can be used as they contain no introns Insoluble, precipitated Lack of eukaryotic post- translational modifications J6 Applications of cloning Fusion protein

80 These problems can be solved by using the eukaryotic expression systems, such as the yeast, Baculovirus and humn cell lines. J6 Applications of cloning

81 J6-3 Genetically modified organisms Genetically modified organisms(GMOs) are created when cloned genes are introduced into germ cells. In eukaryotes, if the introduced genes are derived from another organism, the resulting transgenic plants or animals can be propagated by normal breeding. e.g. A tomato has a gene for a ripening enzyme inactivated J6 Applications of cloning

82 J6-4 DNA fingerprinting How is DNA fingerprinting done? I. Performing Southern blot II. Making a radioactive probe III.Creating a hybridization reaction IV. VNTRs

83 J6 Applications of cloning A given person's VNTRs come from the genetic information donated by his or her parents; he or she could have VNTRs inherited from his or her mother or father, or a combination, but never a VNTR either of his or her parents do not have. Shown in the left are the VNTR patterns for Mrs. Nguyen [blue], Mr. Nguyen [yellow], and their four children: D1 (the Nguyens' biological daughter), D2 (Mr. Nguyen's step-daughter, child of Mrs. Nguyen and her former husband [red]), S1 (the Nguyens' biological son), and S2 (the Nguyens' adopted son, not biologically related [his parents are light and dark green]).

84 The application of DNA fingerprinting: I. Paternity and maternity II.Criminal identification and forensics III.Personal identification J6 Applications of cloning

85 J6-5 Medical diagnosis A great variety of medical conditions arise from mutation. e.g. muscular dystophy, many cancers. By using sequence information to design PCR primers and probes, many tests have been developed to screen patients for these clinically important mutations. J6 Applications of cloning

86 Classical methods for scanning mutations: Complete gene sequencing Single-strand conformation analysis Heteroduplex analysis Chemical cleavage of mismatch and enzymatic cleavage of mismatch Protein-truncation test

87 J6-6 Gene therapy Attempts have been made to treat some genetic disorders by delivering a normal copy of the defective gene to patients. This is known as gene therapy. J6 Applications of cloning

88

89 Fundamentals of Gene Therapy Cell replacement Retroviral vector J6 Applications of cloning

90 Thanks


Download ppt "Section J Analysis of cloned DNA Molecular Biology Course."

Similar presentations


Ads by Google