Section J Analysis of cloned DNA

Name: Section J Analysis of cloned DNA
Uploaded: 2017-08-16T16:07:44+00:00
Duration: PTM38S9
Channel: Aspen Baldwin
Description: Section J Analysis of cloned DNA

Section J Analysis of cloned DNA
Molecular Biology Course Section J Analysis of cloned DNA

J1 Characterization of clones J2 Nucleic acid sequencing
Molecular Biology Course J1 Characterization of clones J2 Nucleic acid sequencing J3 Polymerase chain reaction J4 Organization of cloned genes J5 Mutagenesis of cloned genes J6 Application of cloning

Major Techniques used Restriction mapping Sequencing (DNA & RNA)
Analysis of cloned DNA- overview Major Techniques used Restriction mapping Sequencing (DNA & RNA) Northern and Southern blotting PCR These Techniques may be used for other purpose as well

J1 Characterization of clones
Analysis of cloned DNA J1 Characterization of clones J1-1 Characterization J1-2 Restriction mapping J2-3 Partial digestion J2-4 Labeling nucleic acid J2-5 Southern and Northern blotting

Determining various properties of a recombinant DNA molecule, such as size, restriction map, nucleotide sequence, whether containing a gene (transcribed sequence), the position and polarity of any gene. Preparation of pure DNA is the first step of any characterization

Size of DNA fragment cloned
J1 Characterization of clones Size of DNA fragment cloned Restriction digestion & agarose gel electrophoresis using molecular weight marker 4.0 kb 3.5 kb 3.0 kb 2.0 kb 1.6 kb 1.0 kb insert 0.8 kb 0.5 kb

J1-2 Restriction Mapping
J1 Characterization of clones J1-2 Restriction Mapping Cleavage pattern of the insert DNA by restriction enzymes. Useful in determining the order of multiple fragments (genes). 1. Combinational enzyme digestion 2. Partial digestion

1. Combinational enzyme digestion
J1 Characterization of clones 1. Combinational enzyme digestion l phage Long (left) arm short (right) arm Nonessential region Sal I: 19 kb, 15 kb, 9 kb HindIII: 21 kb, 11 kb, 7 kb, 4 kb SalI + HindIII: 19 kb, 7 kb, 6 kb, 5 kb, 4 kb, 2 kb 19 kb + 2 kb S – H – H – S – H – S 2 kb + 7 kb + 6 kb + 5 kb + 4 kb 19 kb 15 kb 9 kb

Delineate the restriction sites on the DNA
J1 Characterization of clones Delineate the restriction sites on the DNA Long (left) arm short (right) arm Nonessential region S 19 kb 9 kb 15 kb 21 kb H 4 kb 11 kb 7 kb

2. Partial digestion EtBr Stained agarose gel:
J1 Characterization of clones 2. Partial digestion 10 kb insert Complete digestion Partial digestion EtBr Stained agarose gel: Can not delineate the EcoRI sites 10 kb 7 kb 6 kb 4 kb 3 kb 2 kb 1 kb X X

Delineate the restriction sites by partial digested end-labeled radioactive DNA
* 10 kb insert * 6 kb * 4 kb * 3 kb End-labeled radioactive DNA 10 kb 6 kb partial digestion 4 kb 3 kb Agarose electrophoresis autoradiography

End labeling: put the labels at the ends
J1 Characterization of clones J1-4 Labeling of DNA or RNA probes radioactive labeling: display and/or magnify the signals by radioactivity Non-radioactive labeling: display and/or magnify the signals by antigen labeling – antibody binding – enzyme binding - substrate application (signal release End labeling: put the labels at the ends Uniform labeling: put the labels internally

Single stranded DNA/RNA
J1 Characterization of clones End labeling Single stranded DNA/RNA 5’-end labeling: dephosphorylation  polynucleotide kinase (PNK) 3’-end labeling: terminal transferase

Double stranded DNA/RNA
J1 Characterization of clones End labeling Double stranded DNA/RNA Fill in the recessive 3’-ends by DNA polymerase Labeled at both ends 5’pAATTC G G CTTAAp5’ For restriction mapping, cut the DNA with another enzyme

Uniformly labeling of DNA/RNA Nick translation:
J1 Characterization of clones Uniformly labeling of DNA/RNA Nick translation: DNase I to introduce random nicks DNA polI to remove dNMPs from 3’ to 5’ and add new dNMP including labeled nucleotide at the 3’ ends. Hexanucleotide primered labeling: Denature DNA  add random hexanucleotide primers and DNA pol  synthesis of new strand incorporating labeled nucleotide .

Strand-specific DNA probes: e.g.M13 DNA as template
J1 Characterization of clones Strand-specific DNA probes: e.g.M13 DNA as template the missing strand can be re- synthesized by incorporating radioactive nulceotides Strand-specific RNA probes: labeled by transcription

J1-5 Southern and Northern blotting
J1 Characterization of clones J1-5 Southern and Northern blotting DNA on blot RNA on blot Genomic DNA preparation RNA preparation Restriction digestion Denature with alkali Agarose gel electrophoresis  DNA blotting/transfer and fixation RNA 6. Probe labeling  6. Hybridization (temperature)  7. Signal detection (X-ray film or antibody) 

Southern analysis

Steps of Southern blot

Northern analysis COB RNAs in S. cerevisiae
bI1 bI2 bI3 bI4 bI5 mRNA Pre-mRNAs

Blot type Target Probe Applications
J1 Characterization of clones Blot type Target Probe Applications Southern DNA DNA or RNA mapping genomic clones estimating gene numbers Northern RNA RNA sizes, abundance, and expression Western Protein Antibodies protein size, abundance

J2 Nucleic acid sequencing
Analysis and uses of cloned DNA J2 Nucleic acid sequencing J2-1 DNA sequencing J2-2 RNA sequencing J2-3 Sequence databases J2-4 Analysis of sequences J2-5 Genome sequencing projects

J2-1 DNA sequencing J2 nucleic acid sequencing Two main methods:
Maxam and Gilbert chemical method the end-labeled DNA is subjected to base-specific cleavage reactions prior to gel separation. Sanger`s enzymic method () the latter uses dideoxynucleotides as chain terminators to produce a ladder of molecules generated by polymerase extension of primer.

Sanger’s enzymic method
J2 nucleic acid sequencing Sanger’s enzymic method Maxam and Gilbert

J2 nucleic acid sequencing
Maxam and Gilbert chemical method DNA labeled at one end with 32P G C T G C T A Base modification G C T G C T A CH3 Release or displace- ment of reacted bases G C T C T A Strand scission G C T C T A

32pGpCpTpGpCpTpApGpGpTpGpCpCpGpApGpC Chain cleavage at guanines 32p 32pGpCpTp 32pGpCpTpGpCpTpAp Maxam-Gilbert sequencing. We methylate guanines with a mild DMS treatment that methylates on average one guanine per DNA strand.Then use piperidine to remove the methylated base and break the DNA strand at the apurinic site. 32pGpCpTpGpCpTpApGp 32pGpCpTpGpCpTpApGpGpTp 32pGpCpTpGpCpTpApGpGpTpGpCpCp 32pGpCpTpGpCpTpApGpGpTpGpCpCpGpAp 32pGpCpTpGpCpTpApGpGpTpGpCpCpGpApGpC

Sanger sequencing J2 nucleic acid sequencing
This figure shows the structure of a dideoxynucleotide (notice the H atom attached to the 3' carbon). Also depicted in this figure are the ingredients for a Sanger reaction. Notice the different lengths of labeled strands produced in this reaction.

This figure is a representation of an acrylamide sequencing gel. Notice that the sequence of the strand of DNA complementary to the sequenced strand is 5' to 3' ACGCCCGAGTAGCCCAGATT while the sequence of the sequenced strand, 5' to 3', is AATCTGGGCTACTCGGGCGT.

Automatic sequencer J2 nucleic acid sequencing Fluorescence
Labeled ddNTP 2. Polymerase catalyzed

RNA sequencing It is sometimes necessary to sequence RNA directly, especially to determine the position of modified nucleotides present in, eg, tRNA and rRNA. This is achieved by base-specific cleavage of 5’-end-labeled RNA using RNases (ribonuclease) that cleave 3’ to a particular nucleotide. Partial digestion is required to generate a ladder of cleavage products which are analyzed by PAGE.

RNase T1: cleaves after G RNase U2: after A RNase Phy M: after A and U
J2 nucleic acid sequencing RNase T1: cleaves after G RNase U2: after A RNase Phy M: after A and U Bacillus cereus RNase: after U and C

T1 cleaved 0 2 10 20 50 G 43 P 9 P8 P3’ P7 P 6 P5 P4 J3/4 P 2.1 P 2
64 25 95 121/122 157 222 308 P 2 P 2.1 J3/4 P4 P5 P 6 111 P3’ P7 P8 P 9 T1 cleaved

J2-3 Sequence databases Two largest DNA databases of are EMBL in Europe and Genbank in the USA. Newly determined DNA,RNA and protein sequence are entered into databases.The collections of all known sequences are available for analysis by computer.

Sequence database J2 nucleic acid sequencing genebank

Sequence database J2 nucleic acid sequencing EMBL

J2-4 Analysis of sequences
J2 nucleic acid sequencing J2-4 Analysis of sequences Using computers and software packages, such as GCG sequence analysis package offered by Univ. of Wisconsin Identify important sequence features such as restriction sites,open reading frames,start and stop codons, as well as potential promoter sites, intron-exon junctions,etc.

ORF #2 ORF #1 100 200 300 400 500 600 700 Sequence analysis of a cloned DNA sequence revealed some important features

2. compare new sequence with all other known sequences in the databases, which can determine whether related sequences have been obtained before.

J2-5 Genome sequencing projects
J2 nucleic acid sequencing J2-5 Genome sequencing projects With the development of automated DNA sequencers and robotic workstations to prepare samples for sequencing,the entire genome sequence of several organisms have been determined. Many phages and viruses Several Bacteria (E. coli, 4 x 106) Plant (Arabidopsis 6.4 x 107 , rice) Human 3 x 109

J3 Polymerase chain reaction
Analysis and uses of cloned DNA J3 Polymerase chain reaction J3-1 PCR J3-2 The PCR cycle J3-3 Template J3-4 Primers J3-5 Enzymes J3-6 PCR optimization

J3-1 PCR The polymerase chain reaction(PCR) is to used to amplify a sequence of DNA using a pair of primers each complementary to one end of the the DNA target sequence.

J3-2 The PCR cycle Denaturation: The target DNA (template) is separated into two stands by heating to 95℃ Primer annealing: The temperature is reduced to around 55℃ to allow the primers to anneal. Polymerization (elongation, extension): The temperature is increased to 72℃ for optimal polymerization step which uses up dNTPs and required Mg++.

Fig. Steps of PCR Template Primers Enzymes

J3-3 Template Any source of DNA that provides one or more target molecules can in principle be used as a template for PCR Whatever the source of template DNA, PCR can only be applied if some sequence information is known so that primers can be designed.

J3-4 Primers PCR primers need to be about 18 to 30 nt long and have similar G+C contents so that they anneal to their complementary sequences at similar temperatures.They are designed to anneal on opposite strands of the target sequence. Tm=2(a+t)+4(g+c): determine annealing temperature. If the primer is nt, annealing temperature can be Tm5oC

Degenerate primers: an oligo pool derived from protein sequence.
J3 Polymerase chain reaction Degenerate primers: an oligo pool derived from protein sequence. E.g. His-Phe-Pro-Phe-Met-Lys can generate a primer 5’-CAY TTY CCN TTY ATG AAR Y= Pyrimidine N= any base R= purine

J3-5&6 Enzymes and PCR Optimization
J3 Polymerase chain reaction J3-5&6 Enzymes and PCR Optimization The most common is Taq polymerase.It has no 3’ to 5’ proofreading exonuclease activity. Accuracy is low, not good for cloning. We can change the annealing temperature and the Mg++ concentration or carry out nested PCR to optimize PCR.

I.Reverse transcriptase-PCR
J2 nucleic acid sequencing PCR optimization I.Reverse transcriptase-PCR II.Nested PCR

Fig Nested PCR J2 nucleic acid sequencing Gene of interest First round
primers Gene of interest Second round PCR First round PCR Second round primers

Reverse transcriptase-PCR Reverse transcriptase
J2 nucleic acid sequencing Reverse transcriptase-PCR Fig RT-PCR 5‘-Cap mRNA AAA(A)n (dT)12~18 primer anneal 5‘-Cap 3‘ 5‘ AAA(A)n dNTP Reverse transcriptase 5‘-Cap 5‘ Regular PCR AAA(A)n cDNA:mRNA hybrid

J4 Organiztaion of cloned genes
Analysis and uses of cloned DNA J4 Organiztaion of cloned genes J4-1 Organization J4-2Mapping cDNA on Genomic DNA (where) J4-3 S1 nuclease mapping (5’ and 3’ end) J4-4 Primer extension (5’ end) J4-5 Gel retardation (binding protein) J4-6 DNase I footprinting (protein binding sites) J4-7 Reporter genes (promoter study)

J4-1 Organiztion J4 Organization of cloned genes
cDNA clones have defined organization. A run of A residues defines the clone’s 3’-end. There will be a stop codon at its upstream. If the clone is complete, there also will be a start condon. These two codon indicates an ORF.

It can be determined by mapping and probing experiments
J4 Organization of cloned genes The presence and polarity of any gene in a genomic clone is not obvious (5’ and 3’ end) It can be determined by mapping and probing experiments To determine: which genomic sequences are present in the mature mRNA transcript The absent sequences are usually introns and sequences upstream of the transcription start site and down stream of the 3’-processing site. Start and stop sites for transcription regulatory sequences.

J4-2 Mapping cDNA on genomic DNA
J4 Organization of cloned genes J4-2 Mapping cDNA on genomic DNA The genomic clone is digested on a gel and then subjected to Southern blot using all or part of the cDNA as a probe. Using full length cDNA as probe can show which genomic restriction fragments contain sequences also present in the cDNA Using a probe from one end of a cDNA can show the polarity of the gene in the genomic clone. Some of the restriction sites will be common in both clones but may be different distances apart. These can often help to determine the organization of the genomic clone.

J4 Organization of cloned genes
J4-3 S1 nuclease mapping determines the precise 5’- and 3’- ends of RNA transcripts. Sequence ladder is required to determine the precise position S1 nuclease is an enzyme which specifically hydrolyses single-stranded RNA or DNA. RNA 5’ 3’ * DNA 3’ 5’ Add S1 nuclease RNA 5’ 3’ 5’ DNA 3’ PAGE Analysis

J4-4 Primer extension J4 Organization of cloned genes
Determine the 5’ ends of RNA molecules using reverse transcriptase to extend an antisense DNA primer in the 5’ to 3’ direction. Sequence ladder is required to determine the precise position

J4-5 Gel retardation Mixing a protein extract with a labeled DNA fragment and running the mixture on a native gel will show the presence of DNA-protein complex as retarded bands on the gel. Protein bound with DNA/RNA Labeled free DNA/RNA

DNA bound to two proteins DNA-protein complex Bare DNA Fig Gel retardation A short labeled nucleic acid is mixed with a cell or nuclear extract expected to contain the binding protein. Then, samples of labeled nucleic acid, with and without extract, are run on a gel. The DNA-protein complexes are shown by the presence of slowly migrating bands.

J4-6 Dnase I footprinting
J4 Organization of cloned genes J4-6 Dnase I footprinting Identify the actual region of sequence with which the protein interacts. Sequence ladder is required to determine the precise position AATAAG * 5’

Bind protein Fig DNase footprinting The protein protects DNA from attack by DNase. We treat the DNA -protein complex with DNase I under mild conditions, so that an average of only one cut occur per DNA molecule. DNase(mild),then remove protein and denature DNA Electrophoresis, autoradiograph

Protein Conc: T C G A 1 5 The three lanes represent DNA that was bound to 0, 1, and 5 units of protein. The lane with no protein shows a regular ladder of fragments. The lane with one unit shows some protection, and the lane with 5 units shows complete protection in the middle. We usually include sequencing reactions performed on the same DNA in parallel lanes, which tells exactly where the protein bound.

J4-7 Reporter genes To study the function of a control element of a gene (promoter and regulatory elements), reporter genes such as b-galactosidase to “report” the promoter action.

J5 Mutagenesis of cloned genes
Analysis and uses of cloned DNA J5 Mutagenesis of cloned genes J5-1 Deletion mutagenesis J5-2 Site-directed mutagenesis J5-3 PCR mutagenesis

J5-1 Deletion mutagenesis
J5 Mutagenesis of cloned genes J5-1 Deletion mutagenesis In the cDNA clones,it is common to delete progressively from the ends of the coding region to discover with parts of the whole protein have properties. In genomic clones,when the transcription part has been identified,upstream are removed progressively to discover the minimum length of upstream sequence that has promoter and regulatory function .

Exonuclease III S1 or mung bean nuclease Ligation

J5-2 Site-directed mutagenesis
J5 Mutagenesis of cloned genes J5-2 Site-directed mutagenesis Formerly,single-stranded templates prepared using M13 were used,but now PCR techniques are now preferred.

J5-3 PCR mutagenesis Deletion or point mutation
J5 Mutagenesis of cloned genes J5-3 PCR mutagenesis Deletion or point mutation

Forward mutagenic primer SP6 primer T7 primer Reverse mutagenic primer First PCR PCR mutagenesis Two separate PCR reactions are performed, one amplifying the 5’-portion of the insert using SP6 and the reverse primer, and the other amplifying the 3’-portion of the insert using the forward and T7 primers. Remove primers Denature and anneal

Extend and do second PCR SP6 primer T7 primer PCR mutagenesis Two separate PCR reactions are performed, one amplifying the 5’-portion of the insert using SP6 and the reverse primer, and the other amplifying the 3’-portion of the insert using the forward and T7 primers. Subclone

P(deltaP5abc) construction
J5 Mutagenesis of cloned genes PCR P(deltaP5abc) construction E1-P5 P5’-E2 elongation PCR P5abc exon intron

J6 Applications of cloning
Analysis of cloned DNA J6 Applications of cloning J6-1 Applications J6-2 Recombinant protein J6-3Genetically modified organisms J6-4 DNA fingerprinting J6-5 Medical diagnosis J6-5 Gene therapy

J6-1 Applications J6 Applications of cloning CLONING Recombinant
Genetically Modified Organisms DNA fingerprinting CLONING Recombinant protein Gene therapy Medical diagnosis

J6-2 Recombinant protein
J6 Applications of cloning J6-2 Recombinant protein ·Prior to the advent of gene cloning, production of protein was to purify them from tissues. Drawbacks: small amounts, viral contamination etc. ·Gene cloning has circumvented the listed problems.

Prokaryotic expression system can be used to produce eukaryotic proteins, but there are some problems: Only cDNA clones can be used as they contain no introns Insoluble, precipitated Fusion protein Lack of eukaryotic post- translational modifications

These problems can be solved by using the eukaryotic expression systems, such as the yeast, Baculovirus and humn cell lines.

J6-3 Genetically modified organisms
J6 Applications of cloning J6-3 Genetically modified organisms Genetically modified organisms(GMOs) are created when cloned genes are introduced into germ cells. In eukaryotes, if the introduced genes are derived from another organism, the resulting transgenic plants or animals can be propagated by normal breeding. e.g. A tomato has a gene for a ripening enzyme inactivated

J6-4 DNA fingerprinting How is DNA fingerprinting done? I. Performing Southern blot II. Making a radioactive probe III.Creating a hybridization reaction IV. VNTRs

A given person's VNTRs come from the genetic information donated by his or her parents; he or she could have VNTRs inherited from his or her mother or father, or a combination, but never a VNTR either of his or her parents do not have. Shown in the left are the VNTR patterns for Mrs. Nguyen [blue], Mr. Nguyen [yellow], and their four children: D1 (the Nguyens' biological daughter), D2 (Mr. Nguyen's step-daughter, child of Mrs. Nguyen and her former husband [red]), S1 (the Nguyens' biological son), and S2 (the Nguyens' adopted son, not biologically related [his parents are light and dark green]).

The application of DNA fingerprinting: I. Paternity and maternity II.Criminal identification and forensics III.Personal identification

J6-5 Medical diagnosis J6 Applications of cloning
A great variety of medical conditions arise from mutation. e.g. muscular dystophy, many cancers. By using sequence information to design PCR primers and probes, many tests have been developed to screen patients for these clinically important mutations.

Classical methods for scanning mutations:
J6 Applications of cloning Classical methods for scanning mutations: Complete gene sequencing Single-strand conformation analysis Heteroduplex analysis Chemical cleavage of mismatch and enzymatic cleavage of mismatch Protein-truncation test

J6-6 Gene therapy Attempts have been made to treat some genetic disorders by delivering a normal copy of the defective gene to patients. This is known as gene therapy.

Fundamentals of Gene Therapy Retroviral vector Cell replacement

Thanks

Section J Analysis of cloned DNA

Similar presentations

Presentation on theme: "Section J Analysis of cloned DNA"— Presentation transcript:

Similar presentations

About project

Feedback

Log in

Auth with social network:

Section J Analysis of cloned DNA

Similar presentations

Presentation on theme: "Section J Analysis of cloned DNA"— Presentation transcript:

Similar presentations

About project

Feedback