Presentation is loading. Please wait.

Presentation is loading. Please wait.

RNA Therapeutics Institute (RTI) University of Massachusetts Medical School Developmental Robustness MicroRNA Pathways In C. elegans Development.

Similar presentations


Presentation on theme: "RNA Therapeutics Institute (RTI) University of Massachusetts Medical School Developmental Robustness MicroRNA Pathways In C. elegans Development."— Presentation transcript:

1 RNA Therapeutics Institute (RTI) University of Massachusetts Medical School Developmental Robustness MicroRNA Pathways In C. elegans Development

2 microRNA gene Pri-microRNA Pre-microRNA miRNP Inhibition of protein production from mRNA targets Regulation of Gene Expression by Animal MicroRNAs Invertebrates: ~150 microRNA genes Vertebrates: ~1000 microRNA genes Invertebrates: ~150 microRNA genes Vertebrates: ~1000 microRNA genes AGO AnAn GW Effectors Modulators NHL

3 Eumetazoa sponge Animals Plants RNAi lancelet human fly beetle roundworm sea anenome ~10 >100 weed One Pan-Eumetazoan family 1 lancelet human fly beetle roundworm sea anenome mir-100 let-7 mir-125 Hsa-mir-100 AACCCGUAGAUCCGAACUUGUG Cel-mir-52 CACCCGUACAUAUGUUUCCGUGCU How Did/Do MicroRNAs Evolve? MicroRNAs are Endogenous RNAi Agents UGAGGUAGUAGGUUGUAU AGUU UGAGGUAGUAGGUUGUGU GGUU UGAGGUAGUAGGUUGUAU GGUU AGAGGUAGUAGGUUGCAU AGU- UGAGGUAGGAGGUUGUAU AGU- UGAGGUAGUAGAUUGUAU AGUU UGAGGUAGUAGUUUGUAC AGU- UGAGGUAGUAGUUUGUGC UGU- Human let-7-Family UGAGGUAGUAGGUUGUAU AGUU UGAGGUAGGCUCA- GUAGAUGC UGAGGUAGUAUGUAAUAUU GUA UGAGGUAGGUGCGAGAAA UGA- Worm let-7-Family > 35 novel Pan-Bilaterian families lancelet human fly beetle roundworm sea anenome mir-100 let-7 mir-125 ~150 ~800 Fungi mould ~10

4 Worm Fly Human hsa-miR-1 UGGAAUGUAAAGAAGUAUGUAU cel-miR-1 UGGAAUGUAAAGAAGUAUGUA dme-miR-1 UGGAAUGUAAAGAAGUAUGGAG Chen and Rajewsky CSHS 2006 Evolutionary fluidity of target gene sets Explicitly-Homologous

5 HBL-1 differentiation let-60/Ras LIN-41 C. elegans hypodermal lineages LIN-28 let-7 Evolution of MicroRNA-Target Interactions Functionally-Analogous let-7 human cells normal Hmga2 tumor Mayr, Hemann and Bartel, 2007 Explicitly-Homologous

6 lin-4 and let- 7 control developmental timing (1993, 1999). Single gene visible phenotypes Functions of microRNA genes in C. elegans

7 C. elegans “Heterochronic” Mutants lin-4(e912) (Chalfie et al, 1980 ) Wild type

8 lin-4 - Wild Type Retarded Development of lin-4 mutants

9 Adult Alae Formation at L4 Molt LIN-14 over-expression L4 Molt L3 Molt ALAE lin-4 lin-14 3’ UTR Deletion

10 Adult Embryo lin-4 and let-7 microRNAs control cell fate progression Adult let-7 lin-41 lin-41...U AUU U.. UUAUACAACC CUGCCUC GAUAUGUUGG GAUGGAG let-7 UU AU U lin-14..C ACCAA C.. UCACA CUCAGGGA lin-4 AGUGU GAGUCCCU G A A C ACUC Larval stages 7-Fam hbl-1 hbl-1..A CUUGU U.. AACUA CC GCUACCUUA UUGAU GG UGAUGGAGU mir-84 AUGUU A lin-4 lin-14 Utterly Robust Cell Fate Specification and Execution

11 lin-4 and let- 7 control developmental timing (1993, 1999). Single gene visible phenotypes Genetics of microRNA genes in C. elegans Loss of individual microRNAs causes mutant phenotypes in sensitized genetic backgrounds in C. elegans. Brenner et al, … Abbott. Curr Biol. (2010) Visible Phenotypes for 25 of 31 miRNA genes The microRNA miR-1 regulates a MEF-2-dependent retrograde signal at neuromuscular junctions. Simon et al…Ruvkun, Kaplan, Kim. Cell. (2008) Stress the worms Most Caenorhabditis elegans microRNAs are individually not essential for development or viability. Miska, Abbott, Alvarez-Saavedra …Bartel, Ambros, Horvitz. PLoS Genet. (2007) A drag… No New Phenotypes Lucky! The let-7 MicroRNA family … mir-48, mir-84, and mir-241 function together to regulate developmental timing in C. elegans. Abbott et al…Bartel, Horvitz, Ambros. Dev. Cell. (2005) Redundancy within a microRNA family Many families of Caenorhabditis elegans microRNAs are not essential for development or viability Ezequiel Alvarez-Saavedra and H. Robert Horvitz Curr Biol of 15 families are essential

12 Loss of individual microRNAs causes mutant phenotypes in sensitized genetic backgrounds in C. elegans. Brenner Brenner et al, 2010 microRNAs Are Embedded Within Diverse Networks Redundancy between microRNA families Redundancy with gene regulatory “hubs” Robustness thru Redundancy mir-34 mir-83 mir-1 Gonadal Morphogenesis Fertility Argonaute

13 Buffering morphogenetic processes against temperature changes Distinct MicroRNAs with Convergent Targets mir-34 mir-83 pat-3 mRNA peb-1 mRNA PAT-3 Gonadal Morphogenesis PEB-1 Buffered against Temperature changes Samantha Burke & Molly Hammell B-integrin Transcription factor

14 Hermaphrodite Gonad Morphogenesis in C. elegans Phase 1 Phase 3 Phase 2 From Worm Atlas

15 Migration Defects in mir-34 (-/-) and mir-83 (-/-) Mutants Samantha Burke & Molly Hammell

16 Li et al., Carthew Cell (2): Drosophila mir-7 Buffers Eye Development Against Temperature Changes Taking a Cue from Richard Carthew….

17 Constant 20 ℃ Temperature Oscillations Aggravate mir-34 & mir-83 Phenotypes 15 o C – 25 o C Oscillations (8 hr) Samantha Burke & Molly Hammell

18 mir-83(0) mir-34(+) mir-83(+) mir-34(+) mir-83(0) mir-34(0) mir-83(+) mir-34(0) % defective gonadal migration *** Samantha Burke & Molly Hammell

19 Buffering morphogenetic processes against temperature changes Distinct MicroRNAs with Convergent Targets mir-34 mir-83 pat-3 mRNA peb-1 mRNA PAT-3 Gonadal Morphogenesis PEB-1 Buffered against Temperature changes Samantha Burke & Molly Hammell B-integrin Transcription factor

20 AnAn AGO Xantha Karp Modulation of microRNA levels and (lin-4) activity let-7 Family lin-4 Post-dauer: mir-48, mir-84, mir-241, let-7 lin-4: MAJOR Role mir-48, mir-84, mir-241, let-7 lin-4: minor role Continuous: NHL-2

21 Adult Accommodation of Stress and Diapause in C. elegans Development Unfavorable Favorable Dauer- interrupted Larval stages Insulin/IGF DAF-16/Fox0 Dauer larva Continuous

22 Adult Embryo lin-4 and let-7 microRNAs control cell fate progression Adult let-7 lin-41 lin-41...U AUU U.. UUAUACAACC CUGCCUC GAUAUGUUGG GAUGGAG let-7 UU AU U lin-14..C ACCAA C.. UCACA CUCAGGGA lin-4 AGUGU GAGUCCCU G A A C ACUC Larval stages 7-Fam hbl-1 hbl-1..A CUUGU U.. AACUA CC GCUACCUUA UUGAU GG UGAUGGAGU mir-84 AUGUU A lin-4 lin-14 Utterly Robust Cell Fate Specification and Execution (Optional) Developmental Quiescence

23 Adult Embryo Adult let-7 lin-41 Larval stages 7-Fam hbl-1 lin-4 lin-14 (Optional) Developmental Quiescence lin-4 and let-7 microRNAs control cell fate progression Robust Timing of cell fates Dauer larva

24 Adult L1 L2 L4 L3 miR-48 miR-84 miR-241 let-7 lin-4 Wild type LIN-29LIN-41 lin-4 let-7 HBL-1 LIN-14 L1 L2 L3 L4 Ad let-7Fam mir-48 mir-84 mir-241 let-7 Developmental Signals MicroRNA pathways Transcription Factors microRNAs in C. elegans cell fate progression Robust Timing of cell fates LIN-28 Dauer Larva Quiescence

25 LIN-29LIN-41 lin-4 let-7 LIN-14 L1 L2 L3 L4 Ad let-7Fam mir-48 mir-84 mir-241 let-7 Developmental Signals Dosage-Sensitive activity of let-7-Family microRNAs HBL-1 Wild type L1 L2 L3 L4 Ad let-7-Fam -1 UGAGGUAGUAGGUUGUAUAG UU UGAGGUAGGCUCA- GUAGAUGC UGAGGUAGUAUGUAAUAUUG UA UGAGGUAGGUGCGAGAAAUG A- Worm let-7-Family LIN-28

26 LIN-29LIN-41 lin-4 let-7 HBL-1 LIN-14 let-7Fam mir-48 mir-84 mir-241 let-7 Developmental Signals HBL-1 Adult-specific col-19::GFP Normal Retarded L1 L2 L3 L4 Ad L3 L4 L2 UGAGGUAGUAGGUUGUAUAG UU UGAGGUAGGCUCA- GUAGAUGC UGAGGUAGUAUGUAAUAUUG UA UGAGGUAGGUGCGAGAAAUG A- Worm let-7-Family L1 L2 L3 L4 Ad let-7-Fam -3 Wild type LIN-28 Dosage-Sensitive activity of let-7-Family microRNAs

27 Adult-specific col-19::GFP

28 let-7-Fam -3 Healthy environmentStressful environment LIN-29LIN-41 lin-4 let-7 LIN-14 L1 L2 HBL-1 Normal Retarded Developmental Signals HBL-1 Dauer Larva Quiescence “Post-dauer” Suppression Ad L3 L4 L2 L3 L4 let-7Fam mir-48 mir-84 mir-241 let-7 LIN-28

29 Adult-expression of col-19::GFP Wild Type let-7-Fam -3 Continuous Post-dauer Continuous Post-dauer

30 let-7-Fam -3 LIN-29LIN-41 lin-4 let-7 LIN-14 L1 L2 Normal Retarded Developmental Signals High Pheromone Low Pheromone Healthy environment Stressful environment HBL-1 Dauer Larva Quiescence Post-Dauer Suppression Ad L3 L4 let-7Fam mir-48 mir-84 mir-241 let-7 Mod LIN-28 Xantha Karp

31 Post-Dauer Suppression LIN-29LIN-41 lin-4 let-7 LIN-14 L1 L2 HBL-1 Normal Retarded Developmental Signals Mod HBL-1 Retarded High Pheromone Low Pheromone let-7-Fam -3 Mod(0); let-7-Fam -3 let-7-Fam -3 Xantha Karp Dauer Larva Quiescence Ad L3 L4 L2 L3 L4 let-7Fam mir-48 mir-84 mir-241 let-7 LIN-28

32 let-7-Fam -3 LIN-29LIN-41 lin-4 let-7 LIN-14 L1 L2 Normal Retarded Developmental Signals High Pheromone Low Pheromone NHL-2 HBL-1 Dauer Larva Quiescence “Post-Dauer” Suppression Ad L3 L4 let-7Fam mir-48 mir-84 mir-241 let-7 LIN-28 Xantha Karp

33 nhl-2(0); let-7-Fam -3 LIN-29LIN-41 lin-4 let-7 LIN-14 L1 L2 HBL-1 Normal Retarded Developmental Signals NHL-2 HBL-1 Retarded High Pheromone Low Pheromone Dauer Larva Quiescence “Post-Dauer” Suppression Ad L3 L4 L2 L3 L4 let-7Fam mir-48 mir-84 mir-241 let-7 LIN-28 Xantha Karp

34 Post-Dauer let- 7-Fam -3 Post-Dauer nhl-2; let-7-Fam -3 Col-19::GFP expression in Post-Dauer Adults

35 LIN-28 lin-4(0); let-7-Fam -3 “Post-Dauer” Suppression LIN-29LIN-41 lin-4 let-7 LIN-14 L1 L2 HBL-1 Normal Retarded Developmental Signals NHL-2 HBL-1 Retarded High Pheromone Low Pheromone Xantha Karp let-7-Fam -3 Dauer Larva Quiescence Ad L3 L4 L2 L3 L4 let-7Fam mir-48 mir-84 mir-241 let-7

36 L1L2 Dauer larva Post Dauer L3 lin-4 is required for down regulation of HBL-1 Between L2 and Post Dauer L3 L1L2Dauer larvaPost Dauer L3 let-7-Fam -3 WT lin-4; let-7-Fam -3 WT Down Regulated Not Down Regulated HBL-1::GFP::UTR-HBL-1

37 LIN-28 lin-4(0); let-7-Fam -1 LIN-29LIN-41 lin-4 let-7 LIN-14 L1 L2 HBL-1 Developmental Signals NHL-2 HBL-1 Retarded High Pheromone Xantha Karp let-7-Fam -1 Dauer Larva Quiescence Ad L3 L4 L2 L3 L4 let-7Fam mir-48 mir-84 mir-241 let-7 Normal Low Pheromone L2 Ad L3 L4

38 lin-4(0); mir-84(0) mir-84(0) % Adults expressing larval cell fates ** ** P < 0.01 Continuous Post-Quiescence Continuous Post-Quiescence *All strains contain lin-14(n179) Xantha Karp

39 microRNA abundance Dauer vs Continuous lin-4 mir-84 let-7 mir-241 mir-48 Dauer/L2mPDL3/L3PDL4/L4L2D/L2 1.0 Taqman Q-RT/PCR Dauer Traversing vs Continuously-Developing

40 AnAn AGO Xantha Karp Modulation of microRNA levels and (lin-4) activity let-7 Family lin-4 Post-dauer: mir-48, mir-84, mir-241, let-7 lin-4: MAJOR Role mir-48, mir-84, mir-241, let-7 lin-4: minor role Continuous: NHL-2 Insulin/IGF DAF-16/Fox0

41 Physiological Modulation of microRNA activity Enhancers and suppressors of let-7-Family loss-of-function mutations Zhiji Ren, Chris Hammell col-19AlaeDescription rab-7enhance endosomal trafficking vps-11enhance endosomal trafficking vps-33.1/33.2suppress endosomal trafficking pqn-29suppress prion like gene pqn-67suppress prion like gene C01A2.4 (CHMP2B)suppress ESCRT complex nhl-2enhance miRISC modulator cgh-1enhance miRISC essential component lin-46enhance scaffolding protein

42 Bacterial Diet Physiological Modulation of microRNA activity Zhiji Ren

43 Metabolic Signaling Innate Immunity Bacterial Quality/Toxicity mir-48 mir-241 Buffering against food stress mir-84 let-7 Developmental cell fate specification let-7-Family microRNAs in Diet and Development

44


Download ppt "RNA Therapeutics Institute (RTI) University of Massachusetts Medical School Developmental Robustness MicroRNA Pathways In C. elegans Development."

Similar presentations


Ads by Google