Presentation is loading. Please wait.

Presentation is loading. Please wait.

V.Baliuckas Genetikos ir selekcijos skyrius 3.4 Genomų sekvenavimas.

Similar presentations


Presentation on theme: "V.Baliuckas Genetikos ir selekcijos skyrius 3.4 Genomų sekvenavimas."— Presentation transcript:

1 V.Baliuckas Genetikos ir selekcijos skyrius 3.4 Genomų sekvenavimas

2 V.Baliuckas Genetikos ir selekcijos skyrius DNR sekvenavimo metodai: Sengerio (sukurtas 1974 m., modifikuotas 1982 m.) fermentinis metodas V.Rančelis (2000)

3 V.Baliuckas Genetikos ir selekcijos skyrius Maksamo-Gilberto cheminis metodas V.Rančelis (2000) DNR sekvenavimo metodai:

4 V.Baliuckas Genetikos ir selekcijos skyrius automatinis metodas – tai automatizuotas F. Sengerio išrastas metodas DNR sekvenavimo metodai: Chromatografo kreivės Visi dabartiniu metu naudojami genomų sekvenavimo būdai remiasi ‘Shotgun’ automatiniu DNR sekų generavimu

5 V.Baliuckas Genetikos ir selekcijos skyrius Genomo sekvenavimo tikslas gauti pilnai iššifruotą DNR grandinėlę (A, C, G, T). Bibliotekos Sekvenavimas Perdavimas naudojimui Grupavimas/ susiejimas Anotacija Užbaigimas Strategija Dauguma genomų gali būti sekvenuoti be didesnių problemų Klonų gretinimo (hierarchiniu) būdu arba viso genomo sekvenavimas per kartą Subklonavimas; ant gerai žinomų vektorių sudaromos nedidelės “įterpimo” bibliotekos Atskirų DNR fragmentų apjungimas į artimas, kaimynines sulygintų sekų grupes (angl. contig) pagal jų persidengimą Sulygintos sekos apjungiamos į vientisą ištisinę seką-DNR savybės (pasikartojimai/panašumai) -Genų lokalizacija -Peptidų savybės -Pirminis peptidų vaidmens ar paskirties nustatymas -Kitos reguliatorinės sritys

6 V.Baliuckas Genetikos ir selekcijos skyrius Pagrindinės genomo sekvenavimo strategijos Hierarchinė arba klonų gretinimo (angl. Clone by clone): 1.DNR skaidymas į daugybę pakankamai ilgų segmentų ir didelės kolekcija BAC klonų sudarymas. 2. DNR fragmentų sudėliojimas į fizinius genolapius. 3. Minimalaus fragmentų persidengimo varianto suradimas. 4. Kiekvieno varianto klono sekvenavimas su ‘Shotgun’. 5. Fragmentų apjungimas kaimynystės principu į klonų gretinius (angl. contig). 6. Visų fragmentų sujungimas į vientisą seką. Šis būdas panaudotas mielių, kirmėlių, žmogaus, žiurkės genomų sekvenavimui. Hierarchinės strategijos atmaina yra ‘žingsniavimas’ (angl. walking), kai nesudaromi fiziniai genolapiai: 1. DNR skaidymas į daugybę pakankamai ilgų segmentų ir perteklinės BAC klonų kolekcijos sudarymas. 2. Sekvenavimas kiekvieno klono, pirmiausia parinkus keletą kertinių klonų (angl. seed clones). 3. Vientisos sekos konstravimas vis pridedant sekvenuotus prie jau esamų. Tokiu būdu sekvenuotas ryžio genomas. Viso genomo sekvenavimas iš karto (WGS), išvengiant genolapių sudarymo. Šis būdas taikytas sekvenuojant drozofilos, žmogaus, pelės, žiurkės, šuns genomus.

7 V.Baliuckas Genetikos ir selekcijos skyrius genomics_lawson/sanbi_genome_files/ Genomo dydis ir sekvenavimo strategijos Genomo dydis (log Mb) D.melanogaster (170 Mb) C.elegans (100Mb) H.sapiens (3000 Mb) S.cerevisiae (14 Mb) E.coli (4 Mb) P.falciparum (30 Mb) Viso genomo per kartą (WGS) Hierarchinis arba klonavimo Viso genomo per kartą ‘Shotgun’ (WGS) derinant su BAC mažo padengimo klonais (panaudotas žiurkės genomo sekvenavimui) Visos chromosomos (WCS)

8 V.Baliuckas Genetikos ir selekcijos skyrius Vektorių tipai Vektorius Intarpo dydis (bp) Plazmidės2,000-10,000 Kosmidės40,000 BAC (bakterijų dirbtinė chromosoma) 70, ,000 YAC (mielių dirbtinė chromosoma) > 300,000 (vis mažiau naudojama) Vektoriai – struktūros, kuriose laikoma įterpta klonuota svetima DNR. Tai atliekama dviem tikslais: saugoti ir dauginti klonuotą DNR.

9 V.Baliuckas Genetikos ir selekcijos skyrius DNR sekvenavimas – vektoriai + = DNR DNR fragmentai Vektorius (žiedinė plazmidės DNR) Žinoma vieta (restriktazių pažinimo vieta)

10 V.Baliuckas Genetikos ir selekcijos skyrius

11 V.Baliuckas Genetikos ir selekcijos skyrius Genetiniai genolapiai sudaromi pasinaudojant rekombinacijų dažniais ir santykiniais atstumais (cM), o fiziniai – pasinaudojant fiziniais klonuotų DNR sekų atstumais. Genetiniai žymenys naudojami kaip gairės sudarant genolapius: -morfologiniai kategoriniai žymenys, pvz. žmonių hemofilija, daltonizmas, žirnelių raukšlėtumas; -Fiziniai žymenys - RFLP, CAPS, VNTR, STS.

12 V.Baliuckas Genetikos ir selekcijos skyrius

13 V.Baliuckas Genetikos ir selekcijos skyrius Komplementaraus jungimosi būdu gaunamas tikslus molekulinių žymenų išsidėstymas chromosomoje Detalus genolapio STS (angl. sequence- tagged-site) pagrindu sudarymas remiasi klonuotų BAC fragmentų kartografavimu, persidengimo principu (angl. contig).

14 V.Baliuckas Genetikos ir selekcijos skyrius Viso genomo sekvenavimas (WGS)

15 V.Baliuckas Genetikos ir selekcijos skyrius cis595spring2003/

16 V.Baliuckas Genetikos ir selekcijos skyrius Sekvenavimo strategijų privalumai ir trūkumai Hierarchinis sekvenavimas Privalumai: -Lengvesnis apjungimas sekvenuotų fragmentų į klonų gretinius -Reikalauja mažiau kompiuterinių resursų -Yra patikimesnis Trūkumai: -Reikalingi fiziniai genolapiai ir klonų bibliotekos -Daug perteklinio padengimo (angl. redundant sequencing) -Techniškai sudėtingas ir pakankamai brangus Viso genomo sekvenavimas per kartą Privalumai: -Nereikia genolapių -Mažiau perteklinio padengimo -Reikalauja daugiau kompiuterinių resursų -Yra pigesnis Trūkumai: -Sudėtingas sekvenuotų fragmentų apjungimas į klonų gretinius, t.y. eksperimentiškai sudėtingesnis -Reikalauja daugiau kompiuterinių resursų -Nėra patikimas

17 V.Baliuckas Genetikos ir selekcijos skyrius Eukariotų genomų anotacija transkripcija RNR procesingas transliacija AAAAAAA Genominė DNR Pirminė RNR Brandi mRNR Susidarantis polipeptidas susisukimas Reaktantas A Produktas B Funkcija Aktyvus enzimas ab initio genų suradimas Lyginamasis genų išaiškinimas Funkcinė identifikacija Gm 3 Genomo anotacija ar išaiškinimas – tai genus atitinkančių DNR sekų identifikavimas, siekiant atsakyti į klausimus: kiek genų yra ir kuriose genomo vietose, kokius baltymus jie koduoja, kokie yra reguliaciniai mechanizmai ir sąveikos schemos.

18 V.Baliuckas Genetikos ir selekcijos skyrius Struktūrinė anotacija susijusi genų vietos suradimu, homologinių su kitais genomais, cDNA sekomis ir baltymų sekomis DNR grandinės vietų paieška, o taip pat transkripciją reguliuojančių elementų identifikavimu. Funkcinė anotacija susijusi su baltymų molekuline funkcija, jų dalyvavimu apykaitos ir reguliatorinėje veikloje. E.coli genomo vietos fragmentas

19 V.Baliuckas Genetikos ir selekcijos skyrius Start kodonas ATG 5’ 3’ Egzonas 1 Egzonas 2 Egzonas 3 Intronas 1Intronas 2 Stop kodonas TAG/TGA/TAA Susijungimo vietos Ab initio genų metodai paremti specifinių vietų sekose paieška, tokių kaip start ir stop kodonai, ir ribosominės kilpos. Jei nukleotidai sekoje išsidėstę atsitiktinai (tai būdinga introninėms geno dalims, tarpgeninei DNR), maždaug kas dvidešimtas nukleotidų trejetas esti atsitiktinis stop kodonas. Palyginti ilgas DNR fragmentas, kuriame nėra stop kodonų, vadinamas atviru skaitymo rėmeliu (ORF). GenScan, Genie, GeneID kompiuterinės programos yra naudojamos tokio pobūdžio analizei.

20 V.Baliuckas Genetikos ir selekcijos skyrius Kiti genų identifikavimo metodai grindžiami homologija su jau žinomais genais (naudojama GenomeScan kompiuterinė programa). Tokie yra, pvz.: - zooblotingas, kai hibridizuojant naujai nustatyto žmogaus geno DNR sekas su žinomais kitų rūšių (beždžionių, galvijų, pelių, paukščių) genais, galima identifikuoti tų genų analogus žmogaus genome (GeneWise, Procrustes ir kt. kompiuterinės programos); - CpG salelės, kurių buvimas nustatytose DNR sekose padeda rasti visą geną. Šios salelės labiau būdingos bendriniams (angl. housekeeping) genams, pvz., tokiems, kurie koduoja ląstelės energetikai būtinus baltymus ir kt. (Rosseta, SGP1 kompiuterinės programos); - egzono įterpimas (angl. exon trapping) paremtas žiniomis apie tam tikras nukleotidų sekas eukariotų genuose žyminčias introno pradžią ir pabaigą. Jei gautos mDNR ilgis pasikeičia, vadinasi svetimos DNR egzonas buvo atpažintas ir prijungtas (CEM kompiuterinė programa).

21 V.Baliuckas Genetikos ir selekcijos skyrius Genai yra identifikuojami pasinaudojant ekspresuotų sekų žymekliais (EST). Idėja grindžiama tuo, kad identiškos sekos atlieka panašų vaidmenį ir kituose genomuose. Specialios kompiuterinės programos padeda identifikuoti genus pagal nukleotidų sekų išreikštumą (BLASTN, FASTA, TBLASTN). Naujesnės kompiuterinės programos, tokios kaip SGP-2, TwinScan, SLAM, DoubleScan yra sukonstruotos panašumo principu ir naudojamos homologiniams genomų lyginimams. Iškylantys sunkumai : - sunku tiksliai iškart nustatyti genų skaičių - visas genomas sekvenuotas su kai kuriomis pasitaikančiomis klaidomis - mažus genus yra sunku identifikuoti - kai kurie genai retai pasireiškia ir neturi būdingos kodonų struktūros, todėl juos sunku aptikti - genų funkcijos daugumoje yra nežinomos

22 V.Baliuckas Genetikos ir selekcijos skyrius Genomų ypatybės apsprendžia jų sekvenavimo eigos sklandumą GeraiVidutiniškaiBlogai PolimorfizmasHaploidaiSavidulkiniaiKryžmadulkiniai Padengimas žymenimis TankusRetasNėra Fragmentų dydis3kb, 10kb, 50kb, 200kb 3kb, 50kb3kb Klonų pasiskirstymas AtsitiktinisAtsitiktinis kai kurių dydžių fragmentuose Neatsitiktinis daugumoje atvejų BAC galaiDaug poroseNedaug poroseNėra porose ESTDaug 300/MbMažai 100/MbNėra mRNADaugMažaiNėra Padengimas10x6x2x Sekvenavimo paklaidos NėraNedaugDaug Genomo dydis30Mb - 100Mb100Mb - 1Gb>1Gb

23 V.Baliuckas Genetikos ir selekcijos skyrius cis595spring2003/ Naujai įsitvirtinantys sekvenavimo metodai Hibridinis sekvenavimas (SBH) Daugybinis spektrometrinis sekvenavimas Tiesioginė atskiros DNR molekulės vizualizacija naudojant atominę mikroskopiją (AFM) Atskiros molekulės sekvenavimas Atskiro nukleotido metodas Geno ekspresijos ląstelėje nustatymo metodas Sekvenavimas panaudojant nanoporą

24 V.Baliuckas Genetikos ir selekcijos skyrius  globinas Egzonas 2Egzonas 1 Egzonas 3 5’ UTR 3’ UTR (11 chromosoma) Žmogaus genomas *5.000 *20 6*10 4 bp 3.2*10 9 bp *10 3 3*10 3 bp ATTGCCATGTCGATAATTGGACTATTTGGA30 bp Myoglobinas  globinas aa DNR: Baltymas: X Y mitochondrija.016

25 V.Baliuckas Genetikos ir selekcijos skyrius -Genai sudaro ~ 25% viso genomo -Egzonai užima tik 1% Vidutinis žmogaus genas: 27kb ilgio ir koduojančia seka sudarančia 1,340 bp Tik 5% genų atitinka koduojančias sekas (genai skiriasi pagal intronų skaičių) biology/ ppt Žmogaus genomas

26 V.Baliuckas Genetikos ir selekcijos skyrius Egzonai: baltymus koduojantys ir netransliuojamos sritys (UTR) 1 to 178 egzonų gali turėti genas (vidurkis 8.8) 8 bp to 17 kb gali sudaryti egzoną (vidurkis 145 bp) Intronai:nekoduojančios DNR sekos vidutiniškai 1 kb – 50 kb sudaro introną Genų dydis:Didžiausias – 2.4 Mb (Distrofinas). Vidurkis – 27 kb. Eukariotų genomai turi santykinai mažai koduojančių sričių Eukariotų genomus didžiąja dalimi sudaro kartotinės sekos Eukariotų genai yra grupuojami blokuose tarp kartotinių sekų Dėl minėtų priežasčių yra reikalingi paprastesni “modeliniai” genomai

27 V.Baliuckas Genetikos ir selekcijos skyrius Publikuoti pilni genomai: 359 Prokariotų vykstantys genomų dekodavimai: 944 Eukariotų vykstantys genomų dekodavimai: 599 Viso: metų (pirmo ketvirčio) duomenys

28 V.Baliuckas Genetikos ir selekcijos skyrius Steane (2005)

29 V.Baliuckas Genetikos ir selekcijos skyrius Bananas (Musa) Kb Lilium Kb Augalų genomai skiriasi dydžiu, ploidiškumu ir chromosomų skaičiumi Arabidopsis Kb

30 V.Baliuckas Genetikos ir selekcijos skyrius Savolainen O. 2006

31 V.Baliuckas Genetikos ir selekcijos skyrius

32 V.Baliuckas Genetikos ir selekcijos skyrius Ląstelių tipų ir morfologinis kompleksiškumas Genomų dydis nėra proporcingas organizmų kompleksiškumui

33 V.Baliuckas Genetikos ir selekcijos skyrius Kai kurie duomenys apie jau sekvenuotus genomus OrganizmasDydis, bazinės porosApytikslis genų skaičius Chromosomų skaičius Homo sapiens (žmogus) 3,164 mln. bp~30,00046 Rattus norvegicus (žiurkė) 2,750 mln. bp~30,00042 Mus musculus (pelė) 2500 mln. bp~30,00040 Oryza sativa L. (ryžis) 450 mln. bp~40,00012 Drosophila melanogaster (vaisinė muselė) 180 mln. bp13,6008 Arabidopsis thaliana (baltažiedis vairenis) 125 mln. bp25,5005 Caenorhabditis Elegans (apvalioji kirmėlė) 97 mln. bp19,1006 Saccharomyces cerevisiae (mielės) 12 mln. bp Escherichia coli (bakterija) 4.7 mln. bp32001

34 V.Baliuckas Genetikos ir selekcijos skyrius Eriksson and Ekberg (2001) PožymisPinus sppEucalyptus spp Arabidopsis Dydis, pg (haploidinės ląstelės) 240,60,60,15 Chromosomų skaičius12115 Kartotinė DNR (%)75 10 Nesikartojanti DNR (%)25 90 Koduojanti DNR (%)0,313,350 pg=10 12 g

35 V.Baliuckas Genetikos ir selekcijos skyrius Kokios galimos priežastys genomų dydžio skirtumų tarp baltažiedžio vairenio (Arabidopsis) ir daugumos spygliuočių medžių rūšių? - Daugiau resursų reikalaujančios DNR sintezė, matyt, nėra didelis kliuvinys - Svarbu pažymėti, kad didelis genomas koreliuoja su dideliu ląstelės branduoliu, o branduolio dydis savo ruožtu su lėtesne mitozės ir mejozės dalijimosi eiga - Paminėta ypatybė nėra svarbi medžių rūšių išlikimui. Medžiai ir žolės augančios šiaurinėse platumose pasižymi labai nedideliu DNR turiniu. Tikėtina, kad tą lemia trumpas vegetacijos sezonas, nes augalams reikia praeiti keletą vystymosi stadijų - Arabidopsio gyvenimo ciklas labai trumpas 2-3 savaitės nuo sėklos iki sėklos. Tik mažas augalo genomas gali leisti tokį spartų ląstelių dalijimąsi - Pozityvi didelio genomo selekcija vyksta daugelyje spygliuočių medžių rūšių. Paprastai šios rūšys vietoj vandens indų turi tracheides. Yra nustatytas priežastinis teigiamas ryšys tarp tracheides produkuojančių kambio ląstelių ir branduolio DNR dydžio. 18 Š.Amerikos pušų rūšių tyrimai parodė, kad rūšys prisitaikę gyventi nepalankiomis sąlygomis (pusdykumėse) turi didesnį genomą nei augančios optimaliose sąlygose. Eriksson and Ekberg (2001)

36 V.Baliuckas Genetikos ir selekcijos skyrius Literatūros sąrašas Brown G.R., Gill G.P., Kuntz R.J., Langley C.H. and Neale D.B Nucleotide diversity and linkage disequilibrium in loblolly pine. PNAS 101 (42): 15255– Brown GR., Kadel EE. III, Bassoni DL., Kiehne KL., Temesgen B., Buijtenen JP. van, Sewell MM., Marshall KA., Neale DB., van Buijtenen JPAD Anchored reference loci in loblolly pine (Pinus taeda L.) for integrating pine genomics. Genetics, 159 (2): Eriksson G. and Ekberg I An introduction to forest genetics. SLU Repro, Uppsala. Pp Neale DB. and Savolainen O Association genetics of complex traits in conifers. Trends in Plant Science 9: Pavy N., Paule Ch., Parsons L., Crow J.A., Morency M-J., Cooke J., Johnson J.E., Noumen E., Guillet-Claude C., Butterfield Y., Barber S., Yang G., Liu J., Stott J., Kirkpatrick R., Siddiqui A., Holt R., Marra M., Seguin A., Retzel E., Bousquet J. and MacKay J Generation, annotation, analysis and database integration of 16,500 white spruce EST clusters. BMC Genomics 6 (144): Rančelis V Genetika. Lietuvos Mokslų Akademijos leidykla, Vilnius. Pp Steane D Complete Nucleotide Sequence of the Chloroplast Genome from the Tasmanian Blue Gum, Eucalyptus globulus (Myrtaceae). DNA Research 12:


Download ppt "V.Baliuckas Genetikos ir selekcijos skyrius 3.4 Genomų sekvenavimas."

Similar presentations


Ads by Google