Presentation is loading. Please wait.

Presentation is loading. Please wait.

3.4 Genomų sekvenavimas.

Similar presentations


Presentation on theme: "3.4 Genomų sekvenavimas."— Presentation transcript:

1 3.4 Genomų sekvenavimas

2 DNR sekvenavimo metodai:
Sengerio (sukurtas 1974 m., modifikuotas 1982 m.) fermentinis metodas V.Rančelis (2000)

3 DNR sekvenavimo metodai:
Maksamo-Gilberto cheminis metodas V.Rančelis (2000)

4 DNR sekvenavimo metodai:
automatinis metodas – tai automatizuotas F. Sengerio išrastas metodas Visi dabartiniu metu naudojami genomų sekvenavimo būdai remiasi ‘Shotgun’ automatiniu DNR sekų generavimu Chromatografo kreivės

5 Genomo sekvenavimo tikslas gauti pilnai iššifruotą DNR grandinėlę (A, C, G, T).
Bibliotekos Sekvenavimas Perdavimas naudojimui Grupavimas/ susiejimas Anotacija Užbaigimas Strategija Klonų gretinimo (hierarchiniu) būdu arba viso genomo sekvenavimas per kartą Subklonavimas; ant gerai žinomų vektorių sudaromos nedidelės “įterpimo” bibliotekos Dauguma genomų gali būti sekvenuoti be didesnių problemų Atskirų DNR fragmentų apjungimas į artimas, kaimynines sulygintų sekų grupes (angl. contig) pagal jų persidengimą Sulygintos sekos apjungiamos į vientisą ištisinę seką DNR savybės (pasikartojimai/panašumai) Genų lokalizacija Peptidų savybės Pirminis peptidų vaidmens ar paskirties nustatymas Kitos reguliatorinės sritys

6 Pagrindinės genomo sekvenavimo strategijos
Hierarchinė arba klonų gretinimo (angl. Clone by clone): DNR skaidymas į daugybę pakankamai ilgų segmentų ir didelės kolekcija BAC klonų sudarymas. 2. DNR fragmentų sudėliojimas į fizinius genolapius. 3. Minimalaus fragmentų persidengimo varianto suradimas. 4. Kiekvieno varianto klono sekvenavimas su ‘Shotgun’. 5. Fragmentų apjungimas kaimynystės principu į klonų gretinius (angl. contig). 6. Visų fragmentų sujungimas į vientisą seką. Šis būdas panaudotas mielių, kirmėlių, žmogaus, žiurkės genomų sekvenavimui. Hierarchinės strategijos atmaina yra ‘žingsniavimas’ (angl. walking), kai nesudaromi fiziniai genolapiai: DNR skaidymas į daugybę pakankamai ilgų segmentų ir perteklinės BAC klonų kolekcijos sudarymas. Sekvenavimas kiekvieno klono, pirmiausia parinkus keletą kertinių klonų (angl. seed clones). Vientisos sekos konstravimas vis pridedant sekvenuotus prie jau esamų. Tokiu būdu sekvenuotas ryžio genomas. Viso genomo sekvenavimas iš karto (WGS), išvengiant genolapių sudarymo. Šis būdas taikytas sekvenuojant drozofilos, žmogaus, pelės, žiurkės, šuns genomus.

7 Genomo dydis ir sekvenavimo strategijos
Genomo dydis (log Mb) 1 2 3 4 H.sapiens (3000 Mb) D.melanogaster (170 Mb) C.elegans (100Mb) P.falciparum (30 Mb) S.cerevisiae (14 Mb) E.coli (4 Mb) Viso genomo per kartą (WGS) Hierarchinis arba klonavimo Visos chromosomos (WCS) Viso genomo per kartą ‘Shotgun’ (WGS) derinant su BAC mažo padengimo klonais (panaudotas žiurkės genomo sekvenavimui) genomics_lawson/sanbi_genome_files/

8 Vektoriai – struktūros, kuriose laikoma įterpta klonuota svetima DNR
Vektoriai – struktūros, kuriose laikoma įterpta klonuota svetima DNR. Tai atliekama dviem tikslais: saugoti ir dauginti klonuotą DNR. Vektorių tipai Vektorius Intarpo dydis (bp) Plazmidės 2,000-10,000 Kosmidės 40,000 BAC (bakterijų dirbtinė chromosoma) 70, ,000 YAC (mielių dirbtinė chromosoma) > 300,000 (vis mažiau naudojama)

9 DNR sekvenavimas – vektoriai
DNR fragmentai Vektorius (žiedinė plazmidės DNR) Žinoma vieta (restriktazių pažinimo vieta) + =

10

11 Genetiniai genolapiai sudaromi pasinaudojant rekombinacijų dažniais ir santykiniais atstumais (cM), o fiziniai – pasinaudojant fiziniais klonuotų DNR sekų atstumais. Genetiniai žymenys naudojami kaip gairės sudarant genolapius: morfologiniai kategoriniai žymenys, pvz. žmonių hemofilija, daltonizmas, žirnelių raukšlėtumas; Fiziniai žymenys - RFLP, CAPS, VNTR, STS.

12

13 Komplementaraus jungimosi būdu gaunamas tikslus molekulinių žymenų išsidėstymas chromosomoje
Detalus genolapio STS (angl. sequence-tagged-site) pagrindu sudarymas remiasi klonuotų BAC fragmentų kartografavimu, persidengimo principu (angl. contig).

14 Viso genomo sekvenavimas (WGS)

15 www.ist.temple.edu/~vucetic/ cis595spring2003/

16 Sekvenavimo strategijų privalumai ir trūkumai
Hierarchinis sekvenavimas Privalumai: Lengvesnis apjungimas sekvenuotų fragmentų į klonų gretinius - Reikalauja mažiau kompiuterinių resursų Yra patikimesnis Trūkumai: Reikalingi fiziniai genolapiai ir klonų bibliotekos Daug perteklinio padengimo (angl. redundant sequencing) Techniškai sudėtingas ir pakankamai brangus Viso genomo sekvenavimas per kartą Privalumai: Nereikia genolapių Mažiau perteklinio padengimo - Reikalauja daugiau kompiuterinių resursų Yra pigesnis Trūkumai: Sudėtingas sekvenuotų fragmentų apjungimas į klonų gretinius, t.y. eksperimentiškai sudėtingesnis Reikalauja daugiau kompiuterinių - Nėra patikimas

17 Eukariotų genomų anotacija
transkripcija RNR procesingas transliacija AAAAAAA Genominė DNR Pirminė RNR Brandi mRNR Susidarantis polipeptidas susisukimas Reaktantas A Produktas B Funkcija Aktyvus enzimas ab initio genų suradimas Lyginamasis genų išaiškinimas Funkcinė identifikacija Gm3 Genomo anotacija ar išaiškinimas – tai genus atitinkančių DNR sekų identifikavimas, siekiant atsakyti į klausimus: kiek genų yra ir kuriose genomo vietose, kokius baltymus jie koduoja, kokie yra reguliaciniai mechanizmai ir sąveikos schemos.

18 E.coli genomo vietos fragmentas
Struktūrinė anotacija susijusi genų vietos suradimu, homologinių su kitais genomais, cDNA sekomis ir baltymų sekomis DNR grandinės vietų paieška, o taip pat transkripciją reguliuojančių elementų identifikavimu. Funkcinė anotacija susijusi su baltymų molekuline funkcija, jų dalyvavimu apykaitos ir reguliatorinėje veikloje. E.coli genomo vietos fragmentas

19 Ab initio genų metodai paremti specifinių vietų sekose paieška, tokių kaip start ir stop kodonai, ir ribosominės kilpos. Jei nukleotidai sekoje išsidėstę atsitiktinai (tai būdinga introninėms geno dalims, tarpgeninei DNR), maždaug kas dvidešimtas nukleotidų trejetas esti atsitiktinis stop kodonas. Start kodonas ATG 5’ 3’ Egzonas 1 Egzonas 2 Egzonas 3 Intronas 1 Intronas 2 Stop kodonas TAG/TGA/TAA Susijungimo vietos Palyginti ilgas DNR fragmentas, kuriame nėra stop kodonų, vadinamas atviru skaitymo rėmeliu (ORF). GenScan, Genie, GeneID kompiuterinės programos yra naudojamos tokio pobūdžio analizei.

20 Kiti genų identifikavimo metodai grindžiami homologija su jau žinomais genais (naudojama GenomeScan kompiuterinė programa). Tokie yra, pvz.: - zooblotingas, kai hibridizuojant naujai nustatyto žmogaus geno DNR sekas su žinomais kitų rūšių (beždžionių, galvijų, pelių, paukščių) genais, galima identifikuoti tų genų analogus žmogaus genome (GeneWise, Procrustes ir kt. kompiuterinės programos); - CpG salelės, kurių buvimas nustatytose DNR sekose padeda rasti visą geną. Šios salelės labiau būdingos bendriniams (angl. housekeeping) genams, pvz., tokiems, kurie koduoja ląstelės energetikai būtinus baltymus ir kt. (Rosseta, SGP1 kompiuterinės programos); - egzono įterpimas (angl. exon trapping) paremtas žiniomis apie tam tikras nukleotidų sekas eukariotų genuose žyminčias introno pradžią ir pabaigą. Jei gautos mDNR ilgis pasikeičia, vadinasi svetimos DNR egzonas buvo atpažintas ir prijungtas (CEM kompiuterinė programa).

21 Genai yra identifikuojami pasinaudojant ekspresuotų sekų žymekliais (EST). Idėja grindžiama tuo, kad identiškos sekos atlieka panašų vaidmenį ir kituose genomuose. Specialios kompiuterinės programos padeda identifikuoti genus pagal nukleotidų sekų išreikštumą (BLASTN, FASTA, TBLASTN). Naujesnės kompiuterinės programos, tokios kaip SGP-2, TwinScan, SLAM, DoubleScan yra sukonstruotos panašumo principu ir naudojamos homologiniams genomų lyginimams. Iškylantys sunkumai: - sunku tiksliai iškart nustatyti genų skaičių visas genomas sekvenuotas su kai kuriomis pasitaikančiomis klaidomis mažus genus yra sunku identifikuoti kai kurie genai retai pasireiškia ir neturi būdingos kodonų struktūros, todėl juos sunku aptikti genų funkcijos daugumoje yra nežinomos

22 Genomų ypatybės apsprendžia jų sekvenavimo eigos sklandumą
Gerai Vidutiniškai Blogai Polimorfizmas Haploidai Savidulkiniai Kryžmadulkiniai Padengimas žymenimis Tankus Retas Nėra Fragmentų dydis 3kb, 10kb, 50kb, 200kb 3kb, 50kb 3kb Klonų pasiskirstymas Atsitiktinis Atsitiktinis kai kurių dydžių fragmentuose Neatsitiktinis daugumoje atvejų BAC galai Daug porose Nedaug porose Nėra porose EST Daug 300/Mb Mažai 100/Mb mRNA Daug Mažai Padengimas 10x 6x 2x Sekvenavimo paklaidos Nedaug Genomo dydis 30Mb - 100Mb 100Mb - 1Gb >1Gb

23 Naujai įsitvirtinantys sekvenavimo metodai
Hibridinis sekvenavimas (SBH) Daugybinis spektrometrinis sekvenavimas Tiesioginė atskiros DNR molekulės vizualizacija naudojant atominę mikroskopiją (AFM) Atskiros molekulės sekvenavimas Atskiro nukleotido metodas Geno ekspresijos ląstelėje nustatymo metodas Sekvenavimas panaudojant nanoporą cis595spring2003/

24 Žmogaus genomas *5.000 *20 *103 b-globinas 6*104 bp 3*103 bp DNR:
X 4 7 11 16 mitochondrija 5 8 9 10 19 12 20 13 14 15 17 18 21 22 Y .016 72 66 45 48 104 51 88 86 3.2*109 bp 148 118 107 100 163 143 142 140 176 163 148 221 279 197 198 Myoglobinas 251 a globinas *5.000 b-globinas (11 chromosoma) 6*104 bp *20 Egzonas 1 Egzonas 2 Egzonas 3 3*103 bp 5’ UTR 3’ UTR *103 DNR: ATTGCCATGTCGATAATTGGACTATTTGGA 30 bp Baltymas: aa aa aa aa aa aa aa aa aa aa

25 Žmogaus genomas Genai sudaro ~ 25% viso genomo Egzonai užima tik 1%
Vidutinis žmogaus genas: 27kb ilgio ir koduojančia seka sudarančia 1,340 bp Tik 5% genų atitinka koduojančias sekas (genai skiriasi pagal intronų skaičių) biology/ ppt

26 Egzonai: baltymus koduojantys ir netransliuojamos sritys (UTR)
1 to 178 egzonų gali turėti genas (vidurkis 8.8) 8 bp to 17 kb gali sudaryti egzoną (vidurkis 145 bp) Intronai: nekoduojančios DNR sekos vidutiniškai 1 kb – 50 kb sudaro introną Genų dydis: Didžiausias – 2.4 Mb (Distrofinas). Vidurkis – 27 kb. Eukariotų genomai turi santykinai mažai koduojančių sričių Eukariotų genomus didžiąja dalimi sudaro kartotinės sekos Eukariotų genai yra grupuojami blokuose tarp kartotinių sekų Dėl minėtų priežasčių yra reikalingi paprastesni “modeliniai” genomai

27 •Publikuoti pilni genomai: 359 •Prokariotų vykstantys genomų dekodavimai: 944 •Eukariotų vykstantys genomų dekodavimai: 599 •Viso: 1902 2006 metų (pirmo ketvirčio) duomenys

28 Steane (2005)

29 Augalų genomai skiriasi dydžiu, ploidiškumu ir chromosomų skaičiumi
Arabidopsis Kb Bananas (Musa) Kb Lilium Kb

30 Savolainen O. 2006

31

32 Genomų dydis nėra proporcingas organizmų kompleksiškumui
Ląstelių tipų ir morfologinis kompleksiškumas Genomų dydis nėra proporcingas organizmų kompleksiškumui

33 Kai kurie duomenys apie jau sekvenuotus genomus
Organizmas Dydis, bazinės poros Apytikslis genų skaičius Chromosomų skaičius Homo sapiens (žmogus) 3,164 mln. bp ~30,000 46 Rattus norvegicus (žiurkė) 2,750 mln. bp 42 Mus musculus (pelė) 2500 mln. bp 40 Oryza sativa L. (ryžis) 450 mln. bp ~40,000 12 Drosophila melanogaster (vaisinė muselė) 180 mln. bp 13,600 8 Arabidopsis thaliana (baltažiedis vairenis) 125 mln. bp 25,500 5 Caenorhabditis Elegans (apvalioji kirmėlė) 97 mln. bp 19,100 6 Saccharomyces cerevisiae (mielės) 12 mln. bp 6300 16 Escherichia coli (bakterija) 4.7 mln. bp 3200 1

34 Dydis, pg (haploidinės ląstelės) 24 0,6 0,15
Požymis Pinus spp Eucalyptus spp Arabidopsis Dydis, pg (haploidinės ląstelės) 24 0,6 0,15 Chromosomų skaičius 12 11 5 Kartotinė DNR (%) 75 10 Nesikartojanti DNR (%) 25 90 Koduojanti DNR (%) 0,3 13,3 50 pg=1012g Eriksson and Ekberg (2001)

35 Kokios galimos priežastys genomų dydžio skirtumų tarp baltažiedžio vairenio (Arabidopsis) ir daugumos spygliuočių medžių rūšių? - Daugiau resursų reikalaujančios DNR sintezė, matyt, nėra didelis kliuvinys - Svarbu pažymėti, kad didelis genomas koreliuoja su dideliu ląstelės branduoliu, o branduolio dydis savo ruožtu su lėtesne mitozės ir mejozės dalijimosi eiga - Paminėta ypatybė nėra svarbi medžių rūšių išlikimui. Medžiai ir žolės augančios šiaurinėse platumose pasižymi labai nedideliu DNR turiniu. Tikėtina, kad tą lemia trumpas vegetacijos sezonas, nes augalams reikia praeiti keletą vystymosi stadijų - Arabidopsio gyvenimo ciklas labai trumpas 2-3 savaitės nuo sėklos iki sėklos. Tik mažas augalo genomas gali leisti tokį spartų ląstelių dalijimąsi - Pozityvi didelio genomo selekcija vyksta daugelyje spygliuočių medžių rūšių. Paprastai šios rūšys vietoj vandens indų turi tracheides. Yra nustatytas priežastinis teigiamas ryšys tarp tracheides produkuojančių kambio ląstelių ir branduolio DNR dydžio. 18 Š.Amerikos pušų rūšių tyrimai parodė, kad rūšys prisitaikę gyventi nepalankiomis sąlygomis (pusdykumėse) turi didesnį genomą nei augančios optimaliose sąlygose. Eriksson and Ekberg (2001)

36 Literatūros sąrašas Brown G.R., Gill G.P., Kuntz R.J., Langley C.H. and Neale D.B Nucleotide diversity and linkage disequilibrium in loblolly pine. PNAS 101 (42): 15255–15260. Brown GR., Kadel EE. III, Bassoni DL., Kiehne KL., Temesgen B., Buijtenen JP. van, Sewell MM., Marshall KA., Neale DB., van Buijtenen JPAD Anchored reference loci in loblolly pine (Pinus taeda L.) for integrating pine genomics. Genetics, 159 (2): Eriksson G. and Ekberg I An introduction to forest genetics. SLU Repro, Uppsala. Pp. 166. Neale DB. and Savolainen O Association genetics of complex traits in conifers. Trends in Plant Science 9: Pavy N., Paule Ch., Parsons L., Crow J.A., Morency M-J., Cooke J., Johnson J.E., Noumen E., Guillet-Claude C., Butterfield Y., Barber S., Yang G., Liu J., Stott J., Kirkpatrick R., Siddiqui A., Holt R., Marra M., Seguin A., Retzel E., Bousquet J. and MacKay J Generation, annotation, analysis and database integration of 16,500 white spruce EST clusters. BMC Genomics 6 (144): 1-19. Rančelis V Genetika. Lietuvos Mokslų Akademijos leidykla, Vilnius. Pp. 662. Steane D Complete Nucleotide Sequence of the Chloroplast Genome from the Tasmanian Blue Gum, Eucalyptus globulus (Myrtaceae). DNA Research 12:


Download ppt "3.4 Genomų sekvenavimas."

Similar presentations


Ads by Google