Presentation is loading. Please wait.

Presentation is loading. Please wait.

Mapping the Human Genome Genetic Mapping Physical Mapping DNA Sequencing.

Similar presentations


Presentation on theme: "Mapping the Human Genome Genetic Mapping Physical Mapping DNA Sequencing."— Presentation transcript:

1 Mapping the Human Genome Genetic Mapping Physical Mapping DNA Sequencing

2 Physical Mapping Systems Yeast Artificial Chromosomes (YACs) kb Bacteriophage P1 90 kb Cosmids 40 kb Bacteriophage 9-23 kb

3 Large Fragment Cloning Insert Size --- Hybrid cells : multiple chromosomes : Mbp --- Mono-chromosomal hybrids : Mbp --- Sub-chromosomal hybrids : 1-50 Mbp --- Double-minutes : Mbp --- Yeast Artificial Chromosomes : YACs : Mbp --- BACs (F-plasmid derived) : kb --- PACs (large P1 clones) : kb --- T4-packaging system : kb ( kb) --- EBV derived vectors : kb --- P1 + P1 packaging : kb --- Cosmid vectors : kb --- Lambda replacement vectors : kb --- Micro-dissection clones : kb

4 Insertion Vectors –cDNA cloning and expression GT10, GT11, Zap Replacement Vectors –Genomic cloning EMBL3, EMBL 4 Bacteriophage Lambda

5

6

7

8

9

10

11

12 Insertion vector Small inserts (cDNAs) Expression cloning Lambda gt11

13

14 Insertion vector Small inserts (cDNAs) Expression cloning In vivo excision of inserts Lambda Zap

15

16

17 Replacement vector Larger inserts Genomic DNA Spi selection Lambda Fix

18

19 Replacement vector Larger inserts Genomic DNA Spi selection Lambda EMBL3

20

21 SORTED CHROMOSOME ISOLATION PROCEDURE (1) Sort tubes are spun at 3 K rpm for 2 hours at 4 degrees Celsius. (2) The resulting pellet is extracted with Proteinase K/SDS; the sort tube is also extracted to isolate chromosomes adhering to the side of the tube. (3) Both samples are Phenol/CHCl 3 extracted and dialyzed overnight. SORT TUBE 3K rpm Proteinase K/SDS SUPERNATANT Proteinase K/SDS PELLET Proteinase K/SDS SORT TUBE Phenol / CHCl 3 Extract Phenol / CHCl 3 Extract & Dialyze Phenol / CHCl 3 Extract & Dialyze Use for purity 1% analysis of DNA and quantitation Clone into ==> 75-85% Lawrist of DNA Vector Clone into ==> 14-24% Charon of DNA Vector

22 CONSTRUCTION OF LARGE INSERT LAMBDA LIBRARIES Package Amplify on E. Coli host strain K802 (rec A-) Charon 40 Vector ( kb capacity) Polystuffer L arm R arm BamHI cos Polystuffer L arm R arm BamHI cos BamHI (1) Nae 1 (2) PEG precipitation (3) Phenol, chloroform extraction (4) Ethanol precipitation (5) BamHI Ligate Ba Characterize Before Distribution to (ATCC) Plate the Lambda library and screen with probes to identify phage which contain sequences of interest SOURCE DNA FOR CLONING Grow cell (e.g. hybrid cells: J640-51) Grow cell (e.g. hybrid cells: J640-51) Isolate chromosomes by flow-sorting Isolate chromosomes by flow-sorting Purify chromosomes using described protocol Partial digest with MboI / dephosphorylate Partial digest with MboI / dephosphorylate

23 Cosmids –High-copy number replicon –Limited size based on packaging reactions –Chromosome-specific libraries Fosmids –Low-copy replicon (F factor) –Limited size based on packaging reactions –Chromosome-specific libraries Cosmids and Fosmids

24

25 pFOS1 : F-replicon based cosmid vector pUCcos1 1 2 AatII pUCcos1 pBAC cos parB parA repE oriS CM BamHI HindIII cos parB parA repE oriS CM BamHI HindIII cos pFOS1 9.5 kb AatII BamHI Kim, U-J., Shizuya,H, de Jong,P.J., Birren,B., Simon,M., Nucleic Acids Research 1992, 20,

26 LAMBDA ORIGIN COSMID VECTORS (DE JONG ET AL) WITH TWO COS SITES DERIVED FROM LORISTX (P.F.R. LITTLE) LAWRIST5 LAWRIST6 LAWRIST7 LAWRIST8 LAWRIST16 B B B H S Ss N BM BH T7 T3 SP6 SfiI site #1 5’ -GGCCGAAACGGCC- 3’ 3’ -CCGGCTTTGCCGG- 5’ SfiI site #2 5’ -GGCCGCCCCGGCC- 3’ 3’ -CCGGCGGGGCCGG- 5’ Use of SfiI sites for differential end-labeling of insert ends as part of restriction mapping. Labeling by ligating oligo-adapters to ends. AAA GGG TTT CCC VECTOR FRAGMENT INSERT FRAGMENT neo  ori LAWRIST “n” 8.2 kb amp ScaI AatII cos #1 SfiI #2 SfiI T7 H = HindIII B = BamHI Partial HindIII or partial MboI digests S = SalI B = BamHI Partial MboI digest, using partial fill-in of MboI and SalI (vector) sites N = NotI Ss = SstI (Partial MboI + complete NotI or SstII) digests M = Mlul B = BamHI (Partial MboI + complete Mlul) digets H = HindIII B = BamHI Partial HindIII or partial MboI digests USE FOR CLONING OF: For cosmid protocols: “Choice and use of cosmid vectors”, by Peter F.R. Little, in “DNA cloning, Volume 3” (Ed. D.M.Glover, IRL Press, 1987), Please note that the neo marker only contains a prokaryotic promoter. Hence, the cosmids can not be selected with G418 upon transfection into mammalian cells. CLONING SITES:VECTOR:

27 SORTED CHROMOSOME ISOLATION PROCEDURE (1) Sort tubes are spun at 3 K rpm for 2 hours at 4 degrees Celsius. (2) The resulting pellet is extracted with Proteinase K/SDS; the sort tube is also extracted to isolate chromosomes adhering to the side of the tube. (3) Both samples are Phenol/CHCl 3 extracted and dialyzed overnight. SORT TUBE 3K rpm Proteinase K/SDS SUPERNATANT Proteinase K/SDS PELLET Proteinase K/SDS SORT TUBE Phenol / CHCl 3 Extract Phenol / CHCl 3 Extract & Dialyze Phenol / CHCl 3 Extract & Dialyze Use for purity 1% analysis of DNA and quantitation Clone into ==> 75-85% Lawrist of DNA Vector Clone into ==> 14-24% Charon of DNA Vector

28 CONSTRUCTION OF CHROMOSOME-ENRICHED COSMID LIBRARY cos neo  ori LAWRIST 16 Vector amp ScaI cos BamHI Prepare : (1) Digest vector with excess ScaI Vector (2) Dephosphorylate the ScaI ends with excess CIAP Arms (3) Digest the cloning site with BamHI SOURCE DNA FOR CLONING Grow cell (e.g. hybrid cells: J640-51) Grow cell (e.g. hybrid cells: J640-51) Isolate chromosomes by flow-sorting Isolate chromosomes by flow-sorting Purify chromosomes using described protocol Partial digest with MboI / dephosphorylate Partial digest with MboI / dephosphorylate ScaI BamHI ScaI cos BamHIScaI BamHI ScaI cos Infect host DH5  MCR Kanamycin plate ABCDEFGHABCDEFGH Pick clones into microtiter plates, grow, and determine percentage of human clones (hybridize to total human and total hamster DNA probes) cos

29 Insertion Vectors –Large Inserts –Limited to “HEADFULL” –Packaging reaction followed by plasmid propagation Bacteriophage P1

30 pAD10SacBII (30kb) sacB Ad2 pBR322 ori P1 plasmid replicon pac loxP kan P1 lytic replicon sacB Sp6T7 BamH 1 Sfi 1 Not 1 c 1 repressor binding site E.coli promoter Sca 1 kan loxP B B S S pac P1 vector for the construction of recombinants by P1 packaging Pierce et al, Proc. Natl. Acad. Sci.U.S.A. (1992) 89,

31

32 Constructing P1 recombinants using packaging extracts S pac kan loxP B S B packaging loxP B kan loxP B insert of kb site-specific recombination loxP

33 Implications of particle size for P1 recombinant viability loxP B S pac kan loxP B S insert too large maximal insert min. insert insert too small first cut during packaging reaction “HEADFULL” YARD STICK ( kb)

34 Electroporation Based System –Large insert size –Low copy number origin for propagation –High copy origin for DNA production –Negative selection against non-recombinants –Very stable inserts P1 Derived Artificial Chromosomes (PACs)

35 Preparation of pUC19-link GATCTAGAGTACTGGGTTTAAACCCGGATCCGGGTTTAAACCCAGTACTCTA ATCTCATGACCCAAATTTGGGCCTAGGCCCAAATTTGGGTCATGAGATCTAG XbaI ScaI BamHI PmeI Oligonucleotide adapter LL171 pUC19-link EcoRI HindIII B lacZ  amp S S S EcoRI HindIII BamHI lacZ  amp pUC19 S

36 P1 vector for the construction of recombinants by electroporation pAD10SacBII (30kb) plasmid replicon pac loxP kan P1 lytic replicon sacB B S loxP P pac loxP sacB B S loxP B B B S S pUC19-link S loxP plasmid replicon kan P1 lytic replicon sacB pUC19-link BS B S pCYPAC1 (19.3 kb) Insert BamHI-digested pUC19-link into BamHI site of P1 vector 2. Deletion of Ad2-fragment by in vivo site-specific recombination

37 Preparation of vector for cloning P1 lytic replicon loxP plasmid replicon kan sacB B B S S pUC19-link S pCYPAC1 kan B B BS B S S S S S 1 2 B B S S S S 1 2 Digest with BamHI and ScaI Dephosphorylate and remove linkers (Centricon)

38 Sizing of MboI partial-digest fragments CHEF gel electrophoresis NOT stained stained 1 correct size fraction identified ( kb) for ligation for analysis

39 Electroporation Based System –Large insert size –Low copy number origin for propagation –Very stable inserts Bacterial Artificial Chromosomes (BACs)

40

41

42 Large Inserts Not Stable Chimeric inserts Yeast Artificial Chromosomes

43

44 Problems with YACs! 2)Approximately 40 % of the YACs from most libraries are deleted. 3)Low transformation efficiencies. 1)Approximately 40-60% of the YACs from most libraries are chimeric. 4)YACs are very difficult to manipulate.

45 Physical Mapping Systems Yeast Artificial Chromosomes (YACs) kb Bacteriophage P1 90 kb Cosmids 40 kb Bacteriophage 9-23 kb

46 Question of Size? Vector 13,335 P1 Cosmid 1, ,780 6,255 YAC ,667 44, , , ,010 1X 5X 1X 5X Chromosome 19 Human Genome

47 Storage Space? Vector 139 P1 Cosmid YAC ,315 1,042 5,209 1X 5X 1X 5X Chromosome 19 Human Genome

48 Advantages of BACs & PACs 2)Libraries are generated using bacterial hosts with well defined properties. 3)Transformation efficiency is higher than that obtained for YACs. 1)Bacterial based systems that are easy to manipulate. 4)BACs and PACs are non-chimeric, very stable and do not delete sequences.

49 Comparison of BACs & PACs 2)Both systems replicate clones faithfully across generations. 3)PACs also have a negative selection against non-recombinants. 1)Both allow replication of clones at one copy/cell. 4)PACs have an IPTG inducible high copy number origin of replication.

50 Type of Approach A)Bacterial Artificial Chromosomes (BACs). B)P1 Artificial Chromosomes (PACs). C)Yeast Artificial Chromosomes (YACs). D)Cosmids. E)All of the above. Closure of Chromosome 19

51 Yeast Artificial Chromosomes Bacterial Artificial Chromosomes P1 Artificial Chromosomes Cosmids

52 PROPERTYP1pBACpucBACpCYPACYAC Vector Size (kb) Vector Copy #singlesinglemultiplemultiplemultiple Insert Size (kb) Cloning Strategy 2 armssingle digestsingle digestsingle digestdouble digest BamHI/ScaIBam or HindBam or HindBam/Sca linkBam/EcoRI Cloning Method PackagingElectroporateElectroporateElectroporateSpheroplast Maintenance (copy #)singlesinglesinglesinglesingle Chimeric Clones (%)0220 (24/24)20-60 Positive Selectionyesnonoyesyes Copy # Inductionyesnonoyesno Large Fragment Cloning Vectors


Download ppt "Mapping the Human Genome Genetic Mapping Physical Mapping DNA Sequencing."

Similar presentations


Ads by Google