Presentation is loading. Please wait.

Presentation is loading. Please wait.

Validation of a procedure for BAC end mapping on S. lycopersicum x pennellii ILs by: Alessia Fiore, Giulia Falcone ENEA, Casaccia Research Center, Rome.

Similar presentations


Presentation on theme: "Validation of a procedure for BAC end mapping on S. lycopersicum x pennellii ILs by: Alessia Fiore, Giulia Falcone ENEA, Casaccia Research Center, Rome."— Presentation transcript:

1 Validation of a procedure for BAC end mapping on S. lycopersicum x pennellii ILs by: Alessia Fiore, Giulia Falcone ENEA, Casaccia Research Center, Rome

2 Amplification and sequencing of 72 ILs (single pass, SP6 end) PCR primer design on BAC ends Steps Amplification of S. lycopersicum and S. pennellii DNA Polymorphism detection and mapping of SP6 end Confirmation of T7 end on selected ILs Choice of 12 sequenced BACs (1/chromosome) with good end sequences on SGN

3 End sequences > 500bp available on SGN Amplification Primer length: 18-20bp Primer design Parameters: >LE_HBa0051C14_SP6_end CTCATCAACAGCATTGTCAAGGAGCTCTGCCAAGGCTTTAGACATCACAGAACAACA ATGGCTATGTTAACACTCCAGTAATAGCATTTGCAATAATCCTATTACCACACAATAA TATGGAAACGAAAAATGAATCAGCAATAGCACATACCACCAAATGCCCACTTATGG GAAGTGGCGTTTGAGTGAAGGAACTTCGGGTGAATGTGCAAGAAACTGGAGCCTTCT GTATAATGCCACAAATAAGATGACAACATACATATTAGATGCAAAACACATACTTGA ATTACAGATAAAGAATTAAGCTATAAGGCGATATAGAAAGGTAGGCAAAGAAAAGA TTGACCAACTACTCAAAACATCAGCACGCATGGTTTATGCATGGTAATGTGTTTGCTA AGAACAATTTTGAAAAAAGGAAAAAATGGGTACTTCAGTGCATAATACTTTTAAGGG TGGACTTGGTAGCATGCCCCTCATCAAATTTCCAGCTTTCCAGAACTGGCGAGATAG GGGTGCTGGACATATTTGTGATGTAGAACATAGGCTTGAATCATCTATCGGAGACTG ATCTTGATCCAAGACGGAAGTTCTACTCTGTTCAGTAGCTGTAGAATCTTGCCTCCCA CAGCTGCTTGAGGATTTTTTATATGGCAAGGAATCAGCTTCACAGCACTCCATTTGTG GAATTAAACTTTCAACCAATATAGGTTCCAACTTAACAGTCTCTATCTCCCCACCTCC AAGATTGTTACTACACAAGCCAACCATATTTGT Selected BACS

4 Example of A->G mutation on SP6 end LE_HBa0051C14_SP6_lyc LE_HBa0051C14_SP6_penn

5 SP6 end of LE_HBa0051C14: M: 1Kb ladder, V: empty Amplification of IL DNA

6 LE_HBa0006E18, SP6 end: maps to Ils 4.2, 4.3, Mapping of SP6 end

7 Confirmation of T7 end

8 Results

9 Cost considerations (for 96 BACs)


Download ppt "Validation of a procedure for BAC end mapping on S. lycopersicum x pennellii ILs by: Alessia Fiore, Giulia Falcone ENEA, Casaccia Research Center, Rome."

Similar presentations


Ads by Google