Presentation is loading. Please wait.

Presentation is loading. Please wait.

Tcacctcctgtagggcatct ▽ tggttgtttccaccttttgg atgcatagtcacctttttga▲gtagcttttgtatgttaggc …981Ns… gaggagcagtgcttccacac▲tctgaggcggaacatggtggcgcctttctttgcaggggtggctatgtagaga.

Similar presentations


Presentation on theme: "Tcacctcctgtagggcatct ▽ tggttgtttccaccttttgg atgcatagtcacctttttga▲gtagcttttgtatgttaggc …981Ns… gaggagcagtgcttccacac▲tctgaggcggaacatggtggcgcctttctttgcaggggtggctatgtagaga."— Presentation transcript:

1 tcacctcctgtagggcatct ▽ tggttgtttccaccttttgg atgcatagtcacctttttga▲gtagcttttgtatgttaggc …981Ns… gaggagcagtgcttccacac▲tctgaggcggaacatggtggcgcctttctttgcaggggtggctatgtagaga ▽ agttgtcctggacacttcca atgtatcataatttatctcttcacctcctgtagggcatct ▽ agttgtcctggacacttccactgtagtcagaggtcctggg gagggccagtggcagcccttgaggagcagtgcttccacac▲gtagcttttgtatgttaggccagatctgttggtttgtcct NHEJ tttcccccctcttctccccc▲ttccctcatttccaa ▽ c ▽ atagGAGGATCCAAAGTGGG aggaactcccaaatggtctt ▽ c ▽ caaagtggtggaaacattt▲tgcattcctatcagccatga actatgttagctttgtaaggaactcccaaatggtctt ▽ c ▽ atagGAGGATCCAAAGTGGGAATTCCCTCGGAAGAACTT cttcctcccctgtcatcctcacacttttcccccctcttctccccc▲ATA▲tgcattcctatcagccatgaatgagagtctgctgttccacatc “c” nucleotide overlap “ATA” nucleotide insertion NHEJ A B 1,021-nucleotide deletion Germline CCDC6 52-nucleotide deletion Germline RET RET-030 CCDC6-RET RET-CCDC6 Germline KIF5B 19-nucleotide deletion Germline RET 14-nucleotide deletion L07K201T KIF5B-RET RET-KIF5B SUPPLEMENTARY FIGURE 1. Breakpoint and junction sequences of two representative cases with reciprocal inversions deduced to have been mediated by NHEJ. The structures of the two resultant fusion DNAs enabled us to deduce the nucleotide deletions in the RET, CCDC6, and KIF5B loci. Nucleotide insertion at the breakpoint junction, a feature of NHEJ, was observed in L07K201T. ▽, breakpoints for partner- RET fusion; ▲, breakpoints for RET-partner fusion.

2 BR0030 Germline KIF5B Germline RET KIF5B-RET RET-KIF5B cccaatgtgtggatagaactttggtgggagggcagggtggtagtgccagcaggcagggtgagc▲ ctagctgcagtaaatttgaatgatttaactgag……150bp……ttcaccactatcagaatttcacaaggag ggaagatggtaacgttagatgg catggcaggctttggcctccctggtcagagttcaagtactgggggccagggtgggggtctgggaaggcatccggagcagtcccaagtgggcccaatgtgtggatagaactttggtgggagggcagggtggtagtgccagcaggcagggtgagc ▲ ▽ gggtgcgtgagggccagtggcagcccttgaggagcagtgcttccacactctgaggcggaacatggtggcgcctttctttgcaggggtggctatgtagagaagttgtcctggacacttccactgtagtcagaggtcctgggctgggcctggtg Gttgtttttttcctagt ctagctgcagtaaatttgaatgatttaactgag……150bp……ttcaccactatcagaatttcacaaggag ▽ gggtgcgtgagggccagtggcagcccttgaggagcagtgcttccacactctg ttttcctagt▲ ctagctgcag …33Ns… ctaacataaatatgggttatgtatagaaatttaccagaatgatgtgactggtggtaacttgttaa agacttcagaattccagggtgggcaaaactgcagggaaccagtttcctggcttggcaactgaatgaa …26Ns… tcacaaggag ▽ ggaagatggtaa ataaa tatgggttatgtatagaaatttaccagaatgatgtgactggtggtaacttgttaaagacttc--agaattccagggtgggcaaaactgcagggaaccagtttcctggcttggca actga caggc tttggcctccctggtcagagttcaagtactgggggccagggtgggggtctgggaaggcatccggagcagtcccaagtgggcccaatgtgtggatagaactttggtgggagggca gggtg RET KIF5B atatg ggttatgtatagaaatttaccagaatgatgtgactggtggtaacttgttaaagact tcaga agggt ggctatgtagagaagttgtcctggacacttccactg-tagtcagaggtcctgggct gggcc RET KIF5B | ||| | | | | || | || | ||||| || || | | | || | ||| |||||| || || | | ||| ||| |||| || ||||| |||| || || | | | |||| | || | || | || Nucleotide sequence homology Duplication of a KIF5B-derived segment of 211-bp BIR A KIF5B-derived segment of 211-bp duplicated after gene fusion SUPPLEMENTARY FIGURE 2. Breakpoint and junction sequences of two representative cases with reciprocal inversions resulting in segment duplication. (A) A KIF5B segment between two breakpoints ( ▽, KIF5B-RET fusion; ▲, RET-KIF5B fusion) has sequence homology with two regions encompassing breakpoints in the RET locus. The regions exhibiting homology are underlined in red and blue. The resultant fusion DNAs contain duplications of the KIF5B segment.

3 AD12-106T Germline KIF5B Germline RET KIF5B-RET RET-KIF5B ttcttttcctctcatcatatataagctctgttagag ▽ aggatcaggttgatgtcgccctcatgtgctt……430bp……ttgcaggggtggctatgtagagaagttgt cctggacacttccactgtagtcagaggtcct Ccaggtcttggacccatgactcaacctcagtatttgag aggatcaggttgatgtcgccctcatgtgctt……430bp……ttgcaggggtggctatgtagagaagttgt ▲catacagtatgtatatgtagccctttcagct agttaaaaagtgtaaagagagagtggaaatggtttatgtttagtggcagagggatgaaatccaggttccatgactactagatttttttttccactataccatagcagtttgaaaataagtcgtctttgcaaa tagttattctaattaaaaaaaaaaaaggat …51Ns… agctctgttagag ▽ cgttactttt …553Ns… tagttggaat▲catacagtatgtatatgtagccctttcagctagtttctttcactt accagtatgcatttaagattcttccatggcttttcatggcttgatcattttttta RET KIF5B ggatc aggttgatgtcgccc--tcatgt-gcttattgcagtctctagagtgtggtaaacaggtttccagtgc cagct acagt atgtatatgtagccctttcagctagtttctttcacttaccagtatgcatttaagattcttccatggc ttttc | || |||| |||| ||| | | || || || | | || || | || | ||||| || ttg gtgggagggcagggtggtagtgccagcaggcagggtgagcgggtgcgtgagggccag-tggcagcccttgaggagcagtgcttccac---actct-g-aggcggaacatggtggcgcctttctttgcaggggtggctatgtagagaa gtt aaa gtgtaaagagagagtggaaatggttt-atgtttagtg-gcagagggatgaaatccaggttccatgactactagatttttttttccactataccatagcagtttgaaaataa-gtcgtctttgcaaatagttat-tctaattaaaaaa aaa ||| | | || |||| | || | | ||| || | | ||| |||| | || || || | |||||| || | | || ||| || | || |||| || | ||| || | || RET KIF5B Nucleotide sequence homology Duplication of RET-derived segment of 490-bp 573-bp deletion B BIR RET-derived segment of 490-bp duplicated after gene fusion ctcagtatttgag ▽ aggatcaggttgatgtcgccctcatgtgcttattgcagtctctagagtgtggtaaacaggtttccagtgcca……270bp……tggtgggagggcagggtggtagtgccagcaggcagggtga gcgggtgcgtgagggccagtggcagcccttgaggagcagtgcttccacactctgaggcggaacatggtggcgcctttctttgcaggggtggctatgtagagaagttgt ▲cctggacactt SUPPLEMENTARY FIGURE 2. Breakpoint and junction sequences of two representative cases with reciprocal inversions resulting in segment duplication. (B) A RET segment between two breakpoints ( ▽, KIF5B-RET fusion; ▲, RET-KIF5B fusion) has sequence homology with two regions encompassing breakpoints in the KIF5B locus. The regions exhibiting homology are underlined in red and blue. The resultant fusion DNAs contain duplications of the RET segment.

4 K562 H3K4me1 K562 H3K4me3 K562 H3K9ac K562 H3K27me3 NT2-D1 H3K4me1 NT2-D1 H3K4me3 NT2-D1 H3K9ac NT2-D1 H3K27me3 NT2-D1 H3K36me3 U20S H3K9me3 U20S H3K36me ATG stop GC contents DNase susceptibility Conservation in mammalian Repetitive sequence Histone modification by Chip-seq from ENCODE/Stanford/Yale/USC/Harvard RET SUPPLEMENTARY FIGURE 3. DNA and chromatin features of the RET locus. Locations of repetitive sequences are indicated in black. GC content, extent of conservation, DNase susceptibility (DNase I Hypersensitivity Clusters in 125 cell types from ENCODE), and histone modifications are shown by gray boxes, with darker gray indicating a greater extent or magnitude of each parameter. The data was obtained using the UCSC genome browser (http://genome.ucsc.edu/cgi-bin/hgGateway). The exon 11 to intron 11 region is indicated by a red box.http://genome.ucsc.edu/cgi-bin/hgGateway


Download ppt "Tcacctcctgtagggcatct ▽ tggttgtttccaccttttgg atgcatagtcacctttttga▲gtagcttttgtatgttaggc …981Ns… gaggagcagtgcttccacac▲tctgaggcggaacatggtggcgcctttctttgcaggggtggctatgtagaga."

Similar presentations


Ads by Google