Presentation is loading. Please wait.

Presentation is loading. Please wait.

Plasmids Isolation of Plasmid DNA from Bacteria Properties of a Cloning/Expression Vector (Plasmid) Uses of Expression Vectors.

Similar presentations


Presentation on theme: "Plasmids Isolation of Plasmid DNA from Bacteria Properties of a Cloning/Expression Vector (Plasmid) Uses of Expression Vectors."— Presentation transcript:

1 Plasmids Isolation of Plasmid DNA from Bacteria Properties of a Cloning/Expression Vector (Plasmid) Uses of Expression Vectors

2 PLASMID DNA ISOLATION FROM E.Coli Lipopolysaccharide Peptidoglycan Plasma Membrane PLASMID (3-20 kbp) Chromosomal DNA (4 Mbp) Proteins How to isolate plasmid without a commercial kit.

3 Lipopolysaccharide Peptidoglycan Plasma Membrane PLASMID (VECTOR) (3-20 kb) Chromosomal DNA (4 Mbp) Proteins Sol 1 (EDTA, Glucose, Tris pH8) [Binds Mg2+ (interferes with cell wall integrity), breaks outer layer, inhibits DNAses, maintains osmotic pressure, buffers cells at pH 8] Lysozyme (Digests Peptidoglycan) Sol 2 (SDS, NaOH) (Detergent- lyses the cell, denatures proteins including DNAses) Sol 3 (KAc, Acetic Acid) Phenol/Chloroform extraction (Dissociate proteins from nucleic acids) Proteinase K (proteolytic enzyme to remove remaining proteins. Not denatured by SDS) RNAse (Digests RNA) Precipitation of DNA (Isopropanol rapidly ppts nucleic acids. Ethanol removes remaining salt from preparation)

4 The Qiagen Miniprep Kit you will be using Buffer P1- Resuspension Buffer 50mM TrisHCl pH mM EDTA 10 ug/ml RNAse A Buffer P2- Lysis Buffer 200mM NaOH 1% SDS Buffer N3- Neutralizing Buffer Potassium Acetate/Acetic Acid

5 Chromosomal DNA + SDS-protein Complex Plasmid in suspension Use of Silica Gel Membrane Technology Plasmid binds tightly to membrane under high [salt] Elute Impurities Plasmid is eluted under low [salt] using a commercial kit to isolate your plasmid

6 How to quantify of your DNA (Plasmid) 1. DNA can be quantified in an agarose gel by comparing the intensity of the fluorescence emitted by an ethidium bromide-stained DNA sample relative to a dilution series of a DNA standard of known concentration. 2. If the sample is pure (free of RNA, protein, phenol, agarose), a Spectrophotometric method based on measuring the amount of UV irradiation that is absorbed by the bases is accurate and convenient. -DNA concentration is determined from readings at 260nm. -Values are in optical density units (OD) where 1OD=50µg/ml -Eg, if OD=0.2, [DNA]= 50µg/mlx0.2=10µg/ml -If DNA has been diluted, then dilution factor must be included -Eg, (2µlDNA+98µlH2O) with 0.2OD will read: 0.2x50x(1/1000)x50= 500ng/µl Explain? Can you think of a dilution factor(s) you could use that would allow you to determine [DNA] without any mathematical calculations?

7 What is a plasmid ?

8 Expression Vector Shuttle Vector Cloning Vector

9 What are the 3 most important parts of an expression vector ?

10 1. Origin of replication 2. Selectable marker 3. Cloning sites

11 Ori

12 Replicon Contains all info necessary to begin and end DNA replication Origin of replication (Ori) is a defined location within the replicon where DNA synthesis begins

13 The ColE1 Replicon ColE1 naturally occuring plasmid of E.coli. replicates independently of the host genome. DNA Pol bp

14 RNA I : RNA II INTERACTION

15 ROP PROTEIN NEGATIVELY REGULATES RNA II BY STABILIZING RNA I: RNA II INTERACTION

16 Copy number of Vectors Why does pT7T3.pac have a high copy number?

17 There is a point mutation in the origin that alters the initiation of RNAI transcription, such that the RNAI:RNAII complex does not form as well as wild-type. The region of the origin that encodes Rop protein is deleted. Why does pT7T3.pac have a high copy number? 2 REASONS

18 Selectable Marker (Ampicillin Resistance) Ampicillin: -belongs to family of antibiotics called β-lactams -penicillin derivative β-lactam ring Interacts with and inactivates transpeptidase which is responsible for transpeptidation (cross-linking of sugars) Amp R gene codes for β-lactamase which inactivates ampicillin by cleaving the β-lactam ring. Amp R gene: to select for bacteria containing plasmid. -Why does bacteria sustain plasmid replication?

19 Ori EcoRI NotI HindIII VP7

20 Uses of Expression Vectors in Genetic Research Animal models of diseases (Various genetic techniques) Wide range: overexpressing genes to gene silencing Genomic Studies Gene therapy There are many types of Expression Vectors that researchers can choose from. Choice depends on the experiment. Several properties of vectors are essential for function. Features to have: 1. high level of expression 2. tight control 3. subtle modulation

21 Site-Directed Mutagenesis (Use of Vectors and PCR) TCTATGGACCAGTACGATACCAGTA.....CGACCTACGTAGACTAGACGGATAGAG AGATACCTGGTCATGCTATGGTCAT.....GCTGGATGCATCTGATCTGCCTATCTC GAATTCTCTATGGACCAGTACGATACCAGTA.....CGACCTACGTAGACTAGACGGATAGAGGGATCC CTTAAGAGATACCTGGTCATGCTATGGTCAT.....GCTGGATGCATCTGATCTGCCTATCTCCCTAGG Addition of EcoRI(GAATTC) and BamHI (GGATCC) sites and cloning into vector of choice TCGATGGACCAGTACGATACC (mutant forward primer extended) 5’T C G ATGGACCAGTACGATACC----->extension AGATACCTGGTCATGCTATGGTCAT.....GCTGGATGCATCTGATCTGCCTATCTC (First annealing is imperfect because 5’ end of primer is single stranded for 3 nt. After cycle 1, annealing is perfect through all 21 nt and the mutation is copied into product by extension from reverse primer). TCGATGGACCAGTACGATACCAGTA.....CGACCTACGTAGACTAGACGGATAGAG AGCTACCTGGTCATGCTATGGTCAT.....GCTGGATGCATCTGATCTGCCTATCTC

22 Using PCR to Add Additional Restriction Sites Enzymes do not have a high efficiency if they are perched at the end of the DNA molecule. EnzymeOligo Length Chain Length %Cleavage BamHICGGATCCG CGGGATCCCG CGCGGATCCGCG

23 USES OF VECTORS TO GENERATE TRANSGENICS MMTV-LTR Gene X Vector Backbone CGCGTTCTTGAAAAGACAGGTAAAATGCGAGTTCCAGAATGGGTAGAATTGTAAAGT CTGCACGAT CCATATGATCCAGATTGGTATTATATTAGATGTGC TGCTTTAGTTCGTCATATTTATATTCGAAG AGTAACAAAAA TTTTTGGAGGACGCAAACGTAATGGTACTCATCCTAGCCATTTCTGTCGATCGGCAG GTGGTGTTGCTCGCAAAGCTCTTCAGAGCTTGGAACAACTTAAACTCATTGAAAAATC TCCAGTTGGTGGACGTA CGTAGAGATTTAGATCGCATTGC CAAAAAACAACTTAAGTTACAAGAAACTCTTGTTCTC WILD TYPE: MUTANT 1: MUTANT 2: MUTANT 3: MUTANT 4: MUTANT 5: MUTANT 6: * Cloning sites Ori Amp r Vector Backbone Excision/Purification

24 Implant embryos into oviduct of surrogate mouse Genotype progeny (potential founders) using Southern Blot or PCR Identify founders (express transgene) to generate transgenic lines Analyze phenotype, biochemical analyses of tissues, Cross transgenics with other transgenics (bigenics) Integrate transgene into pronucleus of 1 cell embryo (RANDOM INTEGRATION) Transgenic Surrogate

25 Generating Knockout Mice using Expression Vectors in Embryonic Stem Cells Generate Targeting Vector & transfect ES cells derived from blastocyst

26 Homologous recombination of genomic and targeting alleles

27 Random Recombination Random recombination & negative selection

28 Injection of Genetically Engineered ES cells into Blastocysts Neomycin + Ganciclovir Knockout mouse

29

30 Epidermal growth factor receptor (Egfr) Phenotype depends on genetic background: CF-1 background: Degeneration of the inner cell mass Peri-implantation death 129/Sv background: Placental defects Death at mid-gestation CD-1 background: Abnormalities in skin, kidney, brain, liver, and gastrointestinal tract (Threadgill et al., 1995) Death by 3 weeks 129/Sv X C57BL/6 background: Death at birth 129/Sv X C57BL/6 X MF1 background: Death by postnatal day 20 Phenotypic abnormalities in newborn mice (Sibilia and Wagner, 1995) Open eyes Rudimentary whiskers Immature lungs Defects in the epidermis Database of Gene Knockouts GENE KNOCKOUTS LISTED ALPHABETICALLY ACCORDING TO THE NAME OF THE GENE The list can be scrolled through sequentially, or accessed by clicking any of the following letters: A B C D E F G H I J K L M N O P Q R S T U V W X Y Z ABCDEFGHIJKLMNOPQRSTUVWXYZ Example: Embryonic Lethality How do we overcome this limitation?

31 The End


Download ppt "Plasmids Isolation of Plasmid DNA from Bacteria Properties of a Cloning/Expression Vector (Plasmid) Uses of Expression Vectors."

Similar presentations


Ads by Google