Presentation is loading. Please wait.

Presentation is loading. Please wait.

Nick Parkin Trainee Clinical Scientist Wessex Regional Genetics Laboratory A false negative result for Myotonic Dystrophy type 2 using quadruplet primed.

Similar presentations


Presentation on theme: "Nick Parkin Trainee Clinical Scientist Wessex Regional Genetics Laboratory A false negative result for Myotonic Dystrophy type 2 using quadruplet primed."— Presentation transcript:

1 Nick Parkin Trainee Clinical Scientist Wessex Regional Genetics Laboratory A false negative result for Myotonic Dystrophy type 2 using quadruplet primed PCR

2 Myotonic dystrophy type 2 (DM2)/ Proximal Myotonic Myopathy (PROMM) Autosomal dominant, multi-systemic degenerative myopathy characterized by; Progressive muscle weakness, Myotonia Cataracts Cardiac abnormalities Frontal balding Infertility

3 ZNF9 (CNBP1 ) CCTG expansion in intron 1

4 ZNF9 (CNBP1 ) CCTG repeat normal range <75 repeats (including up to 3 interspersions) (TG) n (TCTG) n (CCTG) n CCTG expansion in intron 1 Complicated polymorphic repeat region CCTG affected range 75-11,000 repeats

5 CL3N58D TG n TCTG n CCTG n CL3N58D FCL3N58D R Repeat primer CCTG Tail specific primer CCTG Tail specific primerRepeat primerTail specific primer CCTG Tail specific primerRepeat primerTail specific primer CCTG

6 ZNF9 Southern blotting Somatic mosaicism makes large expansions hard to detect

7 CL3N58D primers (Day et al 2003) 50 presumed normal, 3 known controls (2 negative and 1 positive) Known controls from were patients from Wessex previously tested at another centre 1 of the previously reported negatives tested positive DM2 set up in Wessex

8 Normal vs. expansion image DM2 set up in Wessex Normal

9 DM2 set up in Wessex Positive

10 2 other family members available Also tested positive Samples sent out to other testing laboratories on UKGTN 2 centres found all 3 negative 2 centres (not including my study) found all 3 positive DM2 set up in Wessex

11 Inter-centre audit of DM2 testing strategies Information on other laboratory’s testing acquired and compared CentreTP-PCR P1TP-PCR P3TP-PCR P4 WessexGGCCTTATAACCATGCAAATG(FAM)TACGCATCCGAGTTTGAGACGTACGCATCCGAGTTTGAGACGCAGGCAGGCAGGCAGGCAGG 1GCCTAGGGGACAAAGTGAGA(6-FAM) TACGCATCCCAGTTTGAGACGTACGCATCCCAGTTTGAGACGCCTGCCTGCCTGCCTG TACGCATCCCAGTTTGAGACGBCTGBCTGBCTGBCTG 2GCCTAGGGGACAAAGTGAGA(FAM)TACGCATCCCAGTTTGAGACGTACGCATCCCAGTTTGAGACGCCTGCCTGCCTGCCTG 3GCC TAG GGG ACA AAG TGA GATAC GCA TCC CAG TTT GAG ACG 3’ (DYE 4 labelled)TAC GCA TCC CAG TTT GAG ACG CCT GCC TGC CTG CCT G 4 GCC TAGG GGA CAA AGT GAG A (FAM)TAC GCA TCC CAG TTT GA GAC GTAC GCA TCC CAG TTT GAG ACG CCT GCC TGC CTG CCT G

12 Inter-centre audit of DM2 testing strategies Information on other laboratory’s testing acquired and compared No major differences seen except for the use of the common primer (My testing strategy used the opposite primer to all of the other centres) TaqMixConditions CyclesDenatured?Run On denaturationannealingelongation Epi-centre Fail safePremix J94°C for 1 min51°C for 2 min72°C for 2 minx30No3100 Immolase4.0µl 5.5M betaine94°C for 1 min60°C for 1 min72°C for 2 minx35Yes-95°C3100/3130 Immolase4.0µl 5.5M betaine94°C for 1 min58°C for 1 min72°C for 2 minx35Yes-95°C3100/3130 Amplitaq Gold 1µl DMSO94ºC 1min55ºC* 1min72ºC 2minx32Yes-95°C3100 Megamix1µl DMSO95ºC 30s60ºC 30s72ºC 1minx31Yes-95°C3100 Fast start Taq8µl 5U/µl betaine94°C for 1 min58°C for 1 min72°C for 2 minx35NoCEQ8000 FastStart PCR kitCG rich 5µl94°C for 1 min60°C for 1 min72°C for 2 minx35Yes-95°C3100

13 Data from another of the testing centres Normal Affected family from Wessex +ve control

14 TG n TCTG n CCTG n CL3N58D FCL3N58D R CCTGCCTGCCTGCCTGCCTGCCTGCCTG TCTG TCTCACTTTGTCCCCTAGGC Sequencing of primer sites Sequencing Primer

15 Normal Mutation (c T>C) Mutation not found in 80 normals, more being processed

16 TG n TCTG n CCTG n CL3N58D FCL3N58D R Location of Mutation CCTGCCTGCCTGCCTGCCTGCCTGCCTG TCTG YCTCACTTTGTCCCCTAGGC

17 Conclusions Testing is left short due to overlapping sites Primers need to be re-designed This is difficult due to the high sequence homology upstream Not many viable options TG n TCTG n CCTG n CL3N58D FCL3N58D R Re-designed PCR primers to miss mutation New QP-PCR primers that no longer overlap Optimisation and validation are ongoing

18 Acknowledgements WRGL: Oliver Wood Sophie Marks Phillipa Duncan Esta Cross David Robinson James Macpherson John Harvey Plus: All the scientists that were involved from all the other centres


Download ppt "Nick Parkin Trainee Clinical Scientist Wessex Regional Genetics Laboratory A false negative result for Myotonic Dystrophy type 2 using quadruplet primed."

Similar presentations


Ads by Google