Presentation is loading. Please wait.

Presentation is loading. Please wait.

Good Dataset [A1, A2, A3, A4] [A1, B2, A3, A4] Bad Dataset A B species 1 species 2 species 3 species 4 A1 B1 A2 B2 A4 B4 A3 B3 1. Collect Sequence Data.

Similar presentations


Presentation on theme: "Good Dataset [A1, A2, A3, A4] [A1, B2, A3, A4] Bad Dataset A B species 1 species 2 species 3 species 4 A1 B1 A2 B2 A4 B4 A3 B3 1. Collect Sequence Data."— Presentation transcript:

1 Good Dataset [A1, A2, A3, A4] [A1, B2, A3, A4] Bad Dataset A B species 1 species 2 species 3 species 4 A1 B1 A2 B2 A4 B4 A3 B3 1. Collect Sequence Data Ortholog vs. paralog? OEB 192 – 11.09.14

2 2. Sequence Alignment CGGATAAAC CGGATAGAC CGCTGATAAAC CGGATAC taxa1 taxa2 taxa3 taxa4 Alignment

3 Example: Neighbor Joining (NJ) 4. Choose Methods Taxa Characters Species A ATGGCTATTCTTATAGTACG Species B ATCGCTAGTCTTATATTACA Species C TTCACTAGACCTGTGGTCCA Species D TTGACCAGACCTGTGGTCCG Species E TTGACCAGTTCTCTAGTTCG A B C D E Choose methods: distance-based A B C D E Species A ---- 4 10 9 8 Species B ---- 8 11 10 Species C ---- 3 8 Species D ---- 5 Species E ---- A B C D E Species A ---- 4 10 9 8 Species B -19.3 ---- 8 11 10 Species C -10 -14.7 ---- 3 8 Species D -10.7 -11.3 -16 ---- 5 Species E -12.7 -13.3 -12 -14.7 ---- M(AB)=d(AB) -[(r(A) + r(B))/(N-2)]

4 4. Choose Methods Maximum Parsimony (MP): Model: Evolution goes through the least number of changes Maximum Likelihood (ML): L (data| model) Bayesian Inference Discrete character methods

5 3. Choose Models Ancestral Sequences Observed Sequences ? Model Choose “model”

6 5. Assess Reliability I. Bootstrap Re-sampling to produce pseudo-dataset (random weighting) II. Jacknife Sampling with replacement III. Permutation test Random deletion of sub-dataset Randomize dataset to build null likelihood distribution CGATCGTTA CAATGATAG CGCTGATAA CGCTGATCG taxa1 taxa2 taxa3 taxa4 123456789 100 73 Assess reliability

7 5. Assess Reliability Utility of phylogeny: Molecular clock (Korber et al., 2000)

8 5. Assess Reliability Utility of phylogeny: Molecular clock (Korber et al., 2000)

9 5. Assess Reliability Utility of phylogeny: Molecular clock (Hillis, 2000)

10 Utility of phylogeny: infer past environment? (Gaucher et al., 2003)

11 Molecular signs of selection (Sawyer & Malik, 2006)

12 Genetic exchange in bacteria/archaea

13 Two “types” of HGT…

14 Comparison of HGT to “normal” sex

15 Monday (9/19): Horizontal gene transfer


Download ppt "Good Dataset [A1, A2, A3, A4] [A1, B2, A3, A4] Bad Dataset A B species 1 species 2 species 3 species 4 A1 B1 A2 B2 A4 B4 A3 B3 1. Collect Sequence Data."

Similar presentations


Ads by Google