Presentation is loading. Please wait.

Presentation is loading. Please wait.

In vitro biochemical circuits Leader: Erik Winfree co-leader: Jongmin Kim 1.The synthetic biology problem 2.The experimental system we are investigating.

Similar presentations


Presentation on theme: "In vitro biochemical circuits Leader: Erik Winfree co-leader: Jongmin Kim 1.The synthetic biology problem 2.The experimental system we are investigating."— Presentation transcript:

1 In vitro biochemical circuits Leader: Erik Winfree co-leader: Jongmin Kim 1.The synthetic biology problem 2.The experimental system we are investigating 3.A general problem it motivates 4.A specific problem to tackle

2 In vitro biochemical circuits Leader: Erik Winfree co-leader: Jongmin Kim 1.The synthetic biology problem Reductionism: system behavior from component characteristics The complexity gap Synthesis of in vitro biochemical circuits 2.The experimental system we are investigating 3.A general problem it motivates 4.A specific problem to tackle

3 In vitro biochemical circuits Leader: Erik Winfree co-leader: Jongmin Kim 1.The synthetic biology problem 2.The experimental system we are investigating Circuits of rationally-designed transcriptional switches 3.A general problem it motivates 4.A specific problem to tackle ? RNase RNA DNA RNAP promoter DA R A I R [R] [A] tot [I] tot

4 1.The synthetic biology problem 2.The experimental system we are investigating 3.A general problem it motivates There are many subspecies and side reactions. How do we obtain a simplified model for analysis? 4.A specific problem to tackle By RNA polymerase ON OFF In vitro biochemical circuits Leader: Erik Winfree co-leader: Jongmin Kim By RNase

5 In vitro biochemical circuits Leader: Erik Winfree co-leader: Jongmin Kim 1.The synthetic biology problem 2.The experimental system we are investigating 3.A general problem it motivates 4.A specific problem to tackle Phase space analysis of simple circuits: a bistable switch and a ring oscillator e.g. “cloud size”

6 Mass action chemical kinetics

7 An adjustable transcriptional switch

8 Networks of transcriptional switches By RNA polymerase ON OFF By RNase

9 Michaelis-Menten reactions Michaelis-Menten reactions lead to competition for - RNA polymerase by DNA templates - RNase by RNA products Can have interesting consequences like Winner-take-all network

10 Experimental system

11 Sequence design TCATGGAACTACAACAGGCAACTAATACGACTCACTATAGGGAGAAGCAACGATACGGTCTAGAGTCACTAAGAGTAATACAGAACTGACAAAGTCAGAAA GCTGAGTGATATCCC TC TTCG TTGCTATG CCAGATCTCAGTGATTCT CATTAT GTCTTGACTG TTTC AGTCTTTGTGTTCCT AGTACCTTGATGTT GTCCGTTGATTAT Promoter hairpin AGCAACGATACGGTCTAGAGTCACTAAGAGTAATACAGAA AAA GGGAGA CTGAC GTCAG A A A Signal

12 Components RNAP RNase H RNase R D 12 D 21 A2A2 A1A1 ATTGAGGTAAGAAAGGTAAGGATAATACGACTCACTATAGGGAGAAACAAAGAACGAACGACACTAATGAACTACTACTACACACTAATACTGACAAAGTCAGAAA CTAATGAACTACTACTACACACTAATACGACTCACTATAGGGAGAAGGAGAGGCGAAGATTGAGGTAAGAAAGGTAAGGATAATACTGACAAAGTCAGAAA TATTAGTGTGTAGTAGTAGTTCATTAGTGTCGTTC TATTATCCTTACCTTTCTTACCTCAATCTTCGCCT TTTCTGACTTTGTCAGTATTATCC TT ACC TTT C TT ACCTCAATCTTCGCCTCTCCTTCTCCCTATAGTGAGTCG TTTC TGACTTTGTCAGTATTAGTGTGTAGTAGTAGTTCATTAGTGTCGTTCG TTCTTTGTTTCTCCCTATAGTGAGTCG

13 Transition curve – DNA inhibitor T7 RNAP RNase H(1U) RNase R(200nM) D 21 =100nM A=500nM Sw21 Inh1 Inh2 add DNA Inhibitor 2 A tot dI1 I2

14 Transition curve – RNA inhibitor T7 RNAP RNase H(0.7U) RNase R(150nM) D 13 =0-60nM D 21 =80nM A=400nM A tot Inhibitor 2 Inhibitor 1 Sw21 Sw13 Inh2 Inh1 I2 I1

15 Fluorescence OFF ON High signal Low signal

16 Bistable switch Inh 2 Inh 1 Sw 21 Sw 12

17 Bistable switch Sw 12 ON Sw 21 ON

18 Summary Need better quantitative understanding -make a better system -understand how messy system works Cells have misfolded, mutated species all the time Neural networks have distributed architecture

19 Possible complications

20 Inhibitor interacting with Switch/Enzyme complex D A I RNAP I + RDA -> RD + AI I A D RNAP

21 Abortive transcripts (Messiness #1) D RNAP A D A I R + DA RDA -> R + DA + I 60, I 45, I 14,I 8

22 RNase R needs to clean up I 8, I 14 RNase R Rr + I n RrI n -> Rr

23 Activator crosstalk D 21 A2A2 A2A2 D 21 + A 2 -> D 21 A 2

24 Nicked at -12/-13 has no crosstalk I2I2 A 1 or A 2 D 21 Stoichiometric amounts of activator Transcription level (%) spnonspnon 1x0x1x2x3x1x0x1x2x3x T7 RNAP D 21 =100nM, 500nM D 21 +A 1 D 21 D 21 +A 2

25 Incomplete degradation by RNaseH (Messiness #2) I 45 A hp RNase H A I RhAI -> Rh + A + I n + hp

26 RNase H can keep going I 45 A RNase H I 27 A RNase H I 14 A RNase H Rh + AI n RhAI n -> Rh + AI m I 27 A I 14 A RNase H

27 Lots of truncated RNA products I2 I2 hairpin ? R(0nM)R(100nM)R(200nM)R(400nM) D 21 =30nM A=150nM T7 RNAP RNase H(1.5U) RNase R Sw21 Inh2 sI2

28 Activator-activator or Inhibitor- inhibitor complex II I I I + I -> II

29 RNA extension by RNAP RNAP I I’ RNAP R + I -> RI -> R + I’

30 Extended RNA species R(0nM)R(100nM)R(200nM)R(400nM) D 21 =30nM A=150nM T7 RNAP RNase H(1.5U) RNase R Sw21 Inh2 Extended I2 complex I2

31 Enzyme life-time RNAP R -> ø

32 NTP/buffer exhaustion D RNAP A D A I ATP GTP CTP UTP RDA + 60NTP -> R+ DA + I

33 I2 level is stable (up to ~6hr) R(0nM)R(100nM)R(200nM)R(400nM) D 21 =30nM A=150nM T7 RNAP RNase H(1.5U) RNase R Sw21 Inh2 I2

34 RNase degrading DNA A RNase H Rh + A -> RhA -> Rh

35 DNA bands are stable R(0nM)R(100nM)R(200nM)R(400nM) D 21 =30nM A=150nM T7 RNAP RNase H(1.5U) RNase R Sw21 Inh2 DNA sense DNA temp BH-A

36 Initial burst D RNAP A D A I RDA -> R + DA + I k(t)

37 Model choice (basic) D + A DA A + I AI DA + I DAI -> D + AI R + DA RDA -> R + DA + I R + D RD -> R + D + I Rh + AI RhAI -> Rh + A Rr + I RrI -> Rr

38 Model choice (with messiness) D + A DA A + I n AI n DA + I n DAI n D + AI n R + DA RDA -> R + DA + I n R + DAI 1 n RDAI 1 n -> R + DAI 1 n + I 2 n’ R + D RD -> R + D + I n Rh + AI n RhAI n -> Rh + AI m (+ hp) Rr + I n RrI n -> Rr

39 Questions Bistable circuit phase diagram Oscillator circuit phase diagram Bistable circuit model reduction Oscillator circuit model reduction Transcription switch input/output model reduction


Download ppt "In vitro biochemical circuits Leader: Erik Winfree co-leader: Jongmin Kim 1.The synthetic biology problem 2.The experimental system we are investigating."

Similar presentations


Ads by Google