Presentation is loading. Please wait.

Presentation is loading. Please wait.

Protein domain BioBricks Perry Tsai June 19, 2006.

Similar presentations


Presentation on theme: "Protein domain BioBricks Perry Tsai June 19, 2006."— Presentation transcript:

1 Protein domain BioBricks Perry Tsai June 19, 2006

2 Goals  (1) Demonstrate the use of protein domains in BioBricks assembly (hDlg experiment)  (2) Develop library of BioBrick ’ d protein domains (populate the registry)  (3) Design and construct a novel protein (for its own sake or for other project)

3 The pCMV mammalian expression vector

4 The pCMV mammalian expression vector

5 The pCMV mammalian expression vector

6 The pCMV mammalian expression vector

7 The pCMV mammalian expression vector

8 The pCMV mammalian expression vector

9 pCMV-Tag3A vector BamHI XhoI sticky ends BamHI/XhoI digest Converting multiple cloning site to BioBricks site

10 5’-GATCCTGAATTCGCGGCCGCTTCTAGAGTACTAGTAGCGGCCGCTGCAGC -3’ 3’- GACTTAAGCGCCGGCGAAGATCTCATGATCATCGCCGGCGACGTCGAGCT -5’ BamHI EcoRI NotI XbaI SpeI NotI PstI XhoI BioBricks linker pCMV-Tag3A vector BamHI XhoI sticky ends BamHI/XhoI digest + Converting multiple cloning site to BioBricks site

11 5’-GATCCTGAATTCGCGGCCGCTTCTAGAGTACTAGTAGCGGCCGCTGCAGC -3’ 3’- GACTTAAGCGCCGGCGAAGATCTCATGATCATCGCCGGCGACGTCGAGCT -5’ BamHI EcoRI NotI XbaI SpeI NotI PstI XhoI BioBricks linker pCMV-Tag3A vector BamHI XhoI sticky ends BamHI/XhoI digest + Converting multiple cloning site to BioBricks site pCMV-Tag3A-BB vector pCMV-Tag3A-BB BioBricks site ligase

12 Converting protein domains to BioBricks EcoRI NotI XbaI 5’ GTTTCTCCGAATTCGCGGCCGCTTCTAGAG[Part, 5’->3’ sense] [Part, 3’->5’ antisense]-ATGATCATCGCCGGCGACGTCCCTCTTTG 3’ SpeI NotI PstI 5’ 3’ 5’ Protein domain coding sequence

13 Converting protein domains to BioBricks EcoRI NotI XbaI 5’ GTTTCTCCGAATTCGCGGCCGCTTCTAGAG[Part, 5’->3’ sense] [Part, 3’->5’ antisense]-ATGATCATCGCCGGCGACGTCCCTCTTTG 3’ SpeI NotI PstI 5’ 3’ 5’ Protein domain coding sequence PCR 5’ GTTTCTCCGAATTCGCGGCCGCTTCTAGAG 3’ CAAAGAGGCTTAAGCGCCGGCGAAGATCTC EcoRI NotI XbaI TACTAGTAGCGGCCGCTGCAGGGAGAAAC 3’ ATGATCATCGCCGGCGACGTCCCTCTTTG 5’ SpeI NotI PstI Protein domain coding sequence EcoRI NotI XbaI 5’ GTTTCTCCGAATTCGCGGCCGCTTCTAGAG[Part, 5’->3’ sense] [Part, 3’->5’ antisense]-ATGATCATCGCCGGCGACGTCCCTCTTTG 3’ SpeI NotI PstI

14 Converting protein domains to BioBricks EcoRI NotI XbaI 5’ GTTTCTCCGAATTCGCGGCCGCTTCTAGAG[Part, 5’->3’ sense] [Part, 3’->5’ antisense]-ATGATCATCGCCGGCGACGTCCCTCTTTG 3’ SpeI NotI PstI 5’ 3’ 5’ Protein domain coding sequence PCR 5’ GTTTCTCCGAATTCGCGGCCGCTTCTAGAG 3’ CAAAGAGGCTTAAGCGCCGGCGAAGATCTC EcoRI NotI XbaI TACTAGTAGCGGCCGCTGCAGGGAGAAAC 3’ ATGATCATCGCCGGCGACGTCCCTCTTTG 5’ SpeI NotI PstI XhoI Protein domain coding sequence TOPO cloning TOPO vector Protein domain BioBrick 5’ GTTTCTCCGAATTCGCGGCCGCTTCTAGAG 3’ CAAAGAGGCTTAAGCGCCGGCGAAGATCTC EcoRI NotI XbaI 5’ GTTTCTCCGAATTCGCGGCCGCTTCTAGAG[Part, 5’->3’ sense] [Part, 3’->5’ antisense]-ATGATCATCGCCGGCGACGTCCCTCTTTG 3’ SpeI NotI PstI TACTAGTAGCGGCCGCTGCAGGGAGAAAC 3’ ATGATCATCGCCGGCGACGTCCCTCTTTG 5’ SpeI NotI PstI Caveat: BioBricks restriction sites need to be removed from the coding sequence via site-directed mutagenesis.

15 The hDlg protein McLaughlin M, Hale R, Ellston D, Gaudet S, Lue RA, and Viel A. The distribution and function of alternatively spliced insertions in hDlg. J Biol Chem 2002 Feb 22; 277(8) Human homolog of Drosophila Discs-large tumor suppressor Alternatively spliced isoforms

16 The hDlg protein McLaughlin M, Hale R, Ellston D, Gaudet S, Lue RA, and Viel A. The distribution and function of alternatively spliced insertions in hDlg. J Biol Chem 2002 Feb 22; 277(8) Human homolog of Drosophila Discs-large tumor suppressor Alternatively spliced isoforms Insertions I2, I3, I4, I5

17 The hDlg protein McLaughlin M, Hale R, Ellston D, Gaudet S, Lue RA, and Viel A. The distribution and function of alternatively spliced insertions in hDlg. J Biol Chem 2002 Feb 22; 277(8) Human homolog of Drosophila Discs-large tumor suppressor Alternatively spliced isoforms Insertions I2, I3, I4, I5 I3 targets to plasma membrane; I2 targets to nucleus

18 Mix and match F11 SG25 SG35 I2-I5-I4 PCR to create BioBrick parts 1-9

19 Mix and match PCR to create BioBrick parts 1-9 Assemble into constructs F11 SG25 SG35 I2-I5-I4

20 Progress and agenda  pCMV-Tag3BB vector and BioBrick parts 1-9 have been created, sequenced, and midiprepped. Assemblies have been attempted but not verified.  Next, assemblies need to be completed and verified by sequencing. (3 wks)  Then, constructs can be transfected into human epithelial cells, selected by kanamycin resistance. (2 wks)  Finally, localization of hDlg isoforms will be tested by immunostaining for myc tag. (2 wks)

21 Pros/Cons  Achievable in 1-2 months by 2-3 people  An observable proof of principle  The principle has already been proven. (Silver lab)  Not creative  Not iGEM-y

22 Protein domain BioBricks library  Develop a BioBricks library of protein domains within the Registry  Mix and match protein domains  Model alternatively spliced proteins, like in hDlg experiment  Add, remove, or replace domains for altered functionality  Fuse domains together into chimeric proteins  Design new proteins from characterized domains

23 Types of domains  Receptor (iron, aspartate)  Kinase (tyrosine, serine)  Transmembrane (OmpX)  Localization (nuclear, membrane)  Targeting (intercell)  DNA binding (repressor)

24 Sources of domains  Genomes (E. coli, human, yeast)  cDNA, clone libraries  Synthesis  Mutation  Evolution

25 Agenda  Find out what domains Silver lab has BioBrick ’ d and what may be added to the Registry.  Research other interesting domains, design primers, order primers, DNA sources, and plasmids.(2 wks)  BioBrick parts from chosen protein domains, add BioBricks sites to plasmids if necessary, clone into plasmids..(3 wks)  Modify parts as needed (remove restriction sites, mutations).(1 wk)  Verify parts by sequencing.(1 wk)

26 Pros/Cons  Flexible timeline and goals  Estimated goal of parts in 2 months by 3-4 people  Independent chances at success and failure  Potential to plan for more parts if ahead of schedule  Important for future iGEM teams, future protein domain research  Silver lab experience  Not terribly exciting  Not creative, except choice/modification of parts

27 Designing/constructing a novel protein  Use BioBrick ’ d protein domains to build a new protein  Can be any desired protein, or a protein useful for another project

28 Chimeric protein examples  LamB secretion signal + mature bovine somatotropin  Klein BK, Hill SR, Devine CS, Rowold E, Smith CE, Galosy S, and Olins PO. Secretion of active bovine somatotropin in Escherichia coli. Biotechnology (N Y) 1991 Sep; 9(9)  Aspartate chemoreceptor + EnvZ activator of OmpC transcription  Utsumi R, Brissette RE, Rampersaud A, Forst SA, Oosawa K, and Inouye M. Activation of bacterial porin gene expression by a chimeric signal transducer in response to aspartate. Science 1989 Sep 15; 245(4923)  Aspartate chemoreceptor + human insulin receptor kinase  Moe GR, Bollag GE, and Koshland DE Jr. Transmembrane signaling by a chimera of the Escherichia coli aspartate receptor and the human insulin receptor. Proc Natl Acad Sci U S A 1989 Aug; 86(15)  Iron receptor + beta-galactosidase  Coulton JW, Mason P, Cameron DR, Carmel G, Jean R, and Rode HN. Protein fusions of beta-galactosidase to the ferrichrome-iron receptor of Escherichia coli K-12. J Bacteriol 1986 Jan; 165(1)  Maltose-binding protein + SH2 tyrosine kinase substrate  Sierke SL and Koland JG. SH2 domain proteins as high-affinity receptor tyrosine kinase substrates.

29 Agenda  Design a novel protein, and research necessary domains. Design primers. Order DNA source, primer, plasmid.(1 wk)  BioBrick domains, add BioBrick site to plasmid if necessary, clone into plasmid.(2 wks)  Modify parts as needed (remove restriction sites)(1 wk)  Verify parts by sequencing, while beginning assembly.(1 wk)  Complete assembly, and verify by sequencing.(2 wks)  Test functionality of construct.(1 wk)

30 Pros/Cons  Creative exercise  Applicable and useful to many potential projects  Difficult to ensure success with a novel protein  Protein domains may not be so modular  Tighter timeline because of BioBricking + assembly.

31 Final thoughts  3 projects: (1) hDlg, (2) library, (3) novel protein  Interestingness? 1 < 2 < 3  1 is “ easily ” achievable  2 & 3 have overlapping agendas; feasible with 4-5 people working over 2 months.  2 & 3 require further research  1 & 2 are independent projects, while 3 may depend on 2, and another project may depend on 3

32


Download ppt "Protein domain BioBricks Perry Tsai June 19, 2006."

Similar presentations


Ads by Google