Presentation is loading. Please wait.

Presentation is loading. Please wait.

Francois Vigneault Church Lab CEGS meeting Oct 16th 2008.

Similar presentations


Presentation on theme: "Francois Vigneault Church Lab CEGS meeting Oct 16th 2008."— Presentation transcript:

1 Francois Vigneault Church Lab CEGS meeting Oct 16th 2008

2

3 How to clone miRNAs? X 3’ 3’-OH5’ PO 4 5’ PO 4 5’ PO 4 + X 3’ + T4 RNA ligase ATP

4 How to capture miRNAs? X 3’ 3’-OH5’ PO 4 5’ App 5’ PO 4 + X 3’ + T4 RNA ligase ATP X 3’5’ PO 4

5 How does one make app-Oligo  Lau et al. Science 2001 (Bartel lab)  Yield 10-20%  IDT (5 nmole $ 595)

6 Enzymatic adenylation X 5’ PO 4 3’ 5’ 3’ App T4 DNA Ligase. ATP

7 Pre-adenylation

8 3’adapter ligation

9 5’ adapter ligation

10 High-throughput sequencing  Illumina ~ reads/track for 1200$  Less than ~1000 miRNAs in human cells  Multiplexing up to 50 samples per track (100 fold dynamic range) bring cost per samples to 24$

11 Bar-coded adenylation 3’ GCGC X 5’ PO 4 CCAA X 5’ PO 4 3’ TAGC X 5’ PO 4 3’ ATAT X 5’ PO 4 3’ NNNN 5’ 3’ NNNN 5’ 3’ NNNN 5’ 3’ NNNN 5’ 3’ App T4 DNA Ligase.

12 Bar-coded adenylation 3’ GCGC X 5’ CCAA X 5’3’ TAGC X 5’3’ ATAT X 5’3’ App

13 miRNAs ligation 3’ GCGC X 5’ CCAA X 5’3’ TAGC X 5’3’ ATAT X 5’3’ App 3’-OH5’ PO 4 3’-OH5’ PO 4 3’-OH5’ PO 4 3’-OH5’ PO 4 T4 DNA Ligase

14 miRNAs ligation 3’ GCGC X CCAA X 3’ TAGC X 3’ X ATAT 3’ 5’ PO 4 5’ PO 4 5’ PO 4 5’ PO 4 T4 DNA Ligase

15 5’adapter ligation 3’ NNNN X 5’ PO 4 5’3’-OH T4 DNA Ligase

16 5’adapter ligation 3’ NNNN X 5’ T4 DNA Ligase.

17 RT-PCR 3’ NNNN X 5’ RT pol TAQ pol

18 Sequencing miRNAbarcode

19 Sequencing

20 ATC TGAATCACG GCC TCA AAT GTG GGG ATAT GCGC TAGC CCAA TTG… GTC TTC CCA ATC TCA AAT GGG TTG… ATC TGA GCC GTG ATC TCA AAT GGGATC TGA GCC GTGATCTGA GCC GTG Sequencing.

21 TGAATCACGGCGCAATTTG…ATC GGGATC GCCGGGTAGCTTCATCTTG…TGAGTGATCTGA ATCAATATATTTG…CCATCAGCCAATTGAGCC TCAGTGCCAAGTCGGGTTG…GTGTCAGCCGTG Analysis

22 Expression levels miRNA sequences miRNA profiling TGAATCACGGCGCAATTTG…ATC GGGATCGCCGGGTAGCTTCATCTTG…TGAGTGATCTGA TCAGTG CCAA GTCGGG TTG… GTG TCAGCCGTG Analysis ATCAATATATTTG…CCATCAGCCAATTGAGCC ATCAATATATTTG…CCATCAGCCAATTGAGCC ATCAATATATTTG…CCATCAGCCAATTGAGCC ATCAATATATTTG…CCATCAGCCAATTGAGCC TGAATCACGGCGCAATTTG…ATC GGGATC TGAATCACGGCGCAATTTG…ATC GGGATC TGAATCACGGCGCAATTTG…ATC GGGATC GCCGGGTAGCTTCATCTTG…TGAGTGATCTGA GCCGGGTAGCTTCATCTTG…TGAGTGATCTGA TCAGTG CCAA GTCGGG TTG…GTGTCAGCCGTG TCAGTG CCAA GTCGGG TTG…GTGTCAGCCGTG TCAGTGCCAAGTCGGGTTG…GTGTCAGCCGTG TCAGTGCCAAGTCGGGTTG…GTGTCAGCCGTG Sample1Sample2Sample3Sample4.

23 Projections  Personal Genome Project (PGP)  Induced pluripotent stem cells (iPS)  VDJ-ome

24 VDJ-ome

25 Acknowledgment  George M Church  Michael Sismour  Greg Porreca  Andrew Z Fire and lab  All Church lab members…


Download ppt "Francois Vigneault Church Lab CEGS meeting Oct 16th 2008."

Similar presentations


Ads by Google