Presentation is loading. Please wait.

Presentation is loading. Please wait.

Primer Sequence miRNAsCloning (Forward)Cloning (Reverse) miR-7-1TAATACGACTCACTATAGGGTTGGATGTTGCTGTAGAGGCATGGCCTGTGC miR-7-2TAATACGACTCACTATAGGGCTGGATACAGTGCGATGGCTGGCACCATTAG.

Similar presentations


Presentation on theme: "Primer Sequence miRNAsCloning (Forward)Cloning (Reverse) miR-7-1TAATACGACTCACTATAGGGTTGGATGTTGCTGTAGAGGCATGGCCTGTGC miR-7-2TAATACGACTCACTATAGGGCTGGATACAGTGCGATGGCTGGCACCATTAG."— Presentation transcript:

1 Primer Sequence miRNAsCloning (Forward)Cloning (Reverse) miR-7-1TAATACGACTCACTATAGGGTTGGATGTTGCTGTAGAGGCATGGCCTGTGC miR-7-2TAATACGACTCACTATAGGGCTGGATACAGTGCGATGGCTGGCACCATTAG miR-218-1TAATACGACTCACTATAGGGGTGATAATGTATGTAGAAAGCTGCGTGACGTTCC miR-218-2TAATACGACTCACTATAGGGGACCAGTCGCTGCAGGAGAGCACGGTGCTTTCCG miR-21TAATACGACTCACTATAGGTGTCGGGTAGCTGTCAGACAGCCCATCGACT let-7f-1TAATACGACTCACTATAGGGTCAGAGTGAGTCAGGGAAGGCAATAGATTGTATAGTTATCTCC let-7f-2TAATACGACTCACTATAGGGTGTGGGATGACGTGGGAAAGACAGTAGACTGTATAGTTATC let-7gTAATACGACTCACTATAGGGAGGCTGAGGTTGGCAAGGCAGTGGCCTGTACAGTT let-7iTAATACGACTCACTATAGGGCTGGCTGAGGTAGCAAGGCAGTAGCTTGCGCAGTTATCTC Supplemental Table 1. Primer sequences for cloning and real-time RT-PCR of miRNA precursors. Supplemental Table 1

2 Primer Sequence miRNAsRTPCR ForwardPCR Reverse let-7aGCTCAGACAGAAGTCACACTGAGCAACTATGGGCGGTGAGGTAGTAGGGAAGTCACACTGAGCAACTATACAAC let-7bGCTCAGACAGAAGTCACACTGAGCAACCACSame to let-7aCACACTGAGCAACCACACAAC let-7cGCTCAGACAGAAGTCACACTGAGCAACCATSame to let-7aTCACACTGAGCAACCATACAAC let-7dGCTCAGACAGAAGTCACACTGAGCACTATGGCGGGCGGAGAGGTAGTGTCACACTGAGCACTATGCAAC let-7eGCTCAGACAGAAGTCACACTGAGCACTATACGGGCGGTGAGGTAGGAGAAGTCACACTGAGCACTATACAAC let-7fSame to let-7aCGGGCGGTGAGGTAGTAGAAGAAGTCACACTGAGCAACTATACAAT let-7gGCTCAGACAGAAGTCACACTGAGCACTGTACGGGCGGTGAGGTAGTAGTAAGTCACACTGAGCACTGTACAAA let-7iGCTCAGACAGAAGTCACACTGAGCACAGCACGGGCGGTGAGGTAGTAGTCACACTGAGCACAGCACAAA miR-24CACCGTTCCCCGCCGTCGGTGCTGTTCCCCGCCTGGCTCAGTTCCCGTCGGTGCTGTTCCTG miR-92CACCGTTCCCCGCCGTCGGTGCAGGCCCCCGCCTATTGCACTTGTCGTCGGTGCAGGCCGGG miR-10bGACCGTTCCCCGCCGTCGGTCCACAAACCGCCGTACCCTGTAGAACGTCGGTCCACAAATTCG miR-221CACCGTTCCCCGCCGTCGGTGGAAACCCGGGCAGCTACATTGTCTGCGTCGGTGGAAACCAGCA miR-222CACCGTTCCCCGCCGTCGGTGACCCAGCGGGCAGCTACATCTGGCGTCGGTGACCCAGTAGC miR-21CACCGTTCCCCGCCGTCGGTGTCAACACCCGCCTAGCTTATCAGACTGGCCGTCGGTGTCAACATCA miR-486-5pCACCGTTCCGCGCCGTCGGTGCTCGGGCGCCGTCCTGTACTGAGCTGTCGGTGCTCGGGGCAG miR-451CACGGAACCCCGCCGACCGTGAACTCACGCCGAAACCGTTACCATGCCGACCGTGAACTCAGTAAT miR-15bCACCGTTCCCCGCCGTCGGTGTGTAAACCGCCGTAGCAGCACATCCCGTCGGTGTGTAAACCATG miR-146b-5pCACCGTTCCCCGCCGTCGGTGAGCCTACGGGCGTGAGAACTGAATTCGTCGGTGAGCCTATGGA miR-128CACGGAACCCCGCCGACCGTGAAAGAGGGCGTCACAGTGAACCGCGACCGTGAAAGAGACCG miR-181cCACGGAACCCCGCCGACCGTGACTCACCCGCCGAACATTCAACCTCGACCGTGACTCACCGAC miR-181aSame to miR-181cCGCCGAACATTCAACGCSame to miR-181c miR-181bCACGGAACCCCGCCGACCGTGACCCACCCGCCGAACATTCATTGCGACCGTGACCCACCGAC miR-425GACCGTTCCCCGCCGTCGGTCTCAACGGGGCGAATGACACGATCACCGTCGGTCTCAACGGGAG miR-7CACCGTTCCCCGCCGTCGGTGACAACACGCCCTGGAAGACTAGTGATCCGTCGGTGACAACAAAAT miR-124CACCGTTCCGCGCCGTCGGTGGGCATTCATACCTAAGGCACGCGGGTCGGTGGGCATTCACC miR-137CACCGTTCCCCGCCGTCGGTGCTACGCCCGCCGTTATTGCTTAAGAACGTCGGTGCTACGCGTAT miR-139-5pCACCGTTCCCCGCCGTCGGTGCTGGAGCCGCCTCTACAGTGCACGTCGTCGGTGCTGGAGACAC miR-218CACCGTTCCCCGCCGTCGGTGACATGGTCGGGCTTGTGCTTGATCTCCGTCGGTGACATGGTTAG Supplemental Table 2. Primer sequences for detection of mature miRNAs. Supplemental Table 2

3 miRNART OligonucleotideSequence Tm (°C)∆G RT (kcal/mol)∆G PCR (kcal/mol) miR-21 Stem-loop CACCGTTCCCCGCCGTCGGTGTCAACA Linear GACCCTTCGCGGCCGTCGGTGTCAACA miR-7 Stem-loop CACCGTTCCCCGCCGTCGGTGACAACA Linear GACCCTTCGCGGCCGTCGGTGACAACA miR-218 Stem-loop CACCGTTCCCCGCCGTCGGTGACATGG Linear GACCCTTCGCGGCCGTCGGTGACATGG let-7f Stem-loop GCTCAGACAGAAGTCACACTGAGCAACTAT Linear CGAGAGTCAGAAGTCACACTGAGCAACTAT let-7g Stem-loop GCTCAGACAGAAGTCACACTGAGCACTGTA Linear CGAGAGTCAGAAGTCACACTGAGCACTGTA let-7i Stem-loop GCTCAGACAGAAGTCACACTGAGCACAGCA Linear CGAGAGTCAGAAGTCACACTGAGCACAGCA Supplemental Table 3. Comparison of stem-loop and linear RT oligonucleotides. The most stable secondary structure was adopted to calculate ∆G for linear RT oligonucleotides. Sequence differences between stem-loop and linear RT oligonucleotides for each miRNA are underlined. Supplemental Table 3

4 Supplemental Fig. 1 Extract mature miRNA sequence (seq) Design RT oligonucleotide 1.5’ stem-loop tag seq (stem: 5-6nt; loop: ~11nt) without significant homology to sequences from species of interest (eg. homo sapiens) 2.3’ miRNA-specific seq (6nt, reverse complementary to 3’ of miRNA sequence) 3.Optionally, dU residue can be incorporated in the loop region. Evaluate RT oligonucleotide (mfold) 1.Formation of stable stem-loop secondary structure at RT condition (∆G  -0.5 kcal/mol) 2.Does not form stable stem-loop secondary structure at PCR condition (∆G  -0.5 kcal/mol) Reaction Conditions RT: Na + = 75 mM, Mg 2+ = 3 mM, Temp = 42°C PCR: Na + = 50 mM, Mg 2+ = 2.5 mM, Temp = 60°C Design hemi-nested real-time PCR primer 1.Forward primer (Tm  58°C) with 5’ tag seq to increase Tm and 3’ miRNA specific seq (~12nt) 2.Reverse primer (Tm  58°C) with partial stem-loop tag seq (8-10nt) and miRNA specific seq (9-11nt, including 6nt used in RT and 3-5nt 3’ protruding seq). hsa-miR-21: 5’- uagcuuaucagacugauguuga -3’ 5’- CACCGTTCCCCGCCGTCGGTGTCAACA -3’ StemloopStem miR-21 specific seq (RT) RT Oligonucleotide: 5’- CCCGCCTAGCTTATCAGACTG -3’ Tag seqmiR-21 specific seq 5’- GCCGTCGGTGTCAACATCA -3’ Partial stem- loop tag seq miR-21 specific seq (RT)(Hemi-nested PCR) 5’- -3’ ∆G RT = kcal/mol ∆G PCR = 0.19 kcal/mol Forward Primer: Reverse Primer: Assay Design FlowchartExample (hsa-miR-21) (dU) Supplemental Fig. 1. Flow Chart and example for designing hemi-nested real-time RT-PCR assay.

5 A let-7d B let-7e Supplemental Fig. 2. Quantification of synthetic let-7d and let-7e miRNA dilutions with U251 total RNA spike-in. Standard dilutions (10 9, 10 8 and 10 7 copies) of synthetic let-7d (A) or let-7e (B) were spiked with 100 ng of total RNA isolated from U251 cells. Control miRNA dilutions or total RNA spiked-in miRNA dilutions were reverse transcribed with let-7d or let-7e RT primers. The cDNA samples (10% v/v) were amplified by real-time PCR. Standard curves were plotted as Ct versus Log (Copies of miRNA per RT). Supplemental Fig. 2

6 Supplemental Fig. 3. Dynamic range and efficiency of miR-24 (A, B), miR-92 (C, D) and miR-218 (E, F) real-time RT- PCR assays. Standard dilutions of synthetic miR-24, -92 and -218 were reverse transcribed with miRNA-specific RT oligonucleotide. The cDNA samples (10% v/v) were amplified by real-time PCR along with non-template control (NTC). Amplification plots (A, C, E) and standard curves (B, D, F) of the assay were shown. Standard curves were plotted as Ct versus Log (Copies of miRNA per RT). Supplemental Fig. 3 A 10 9 NTC 10 3 miR NTC 10 3 miR NTC 10 4 miR-218 B D F C E

7 Supplemental Fig. 4. Gel electrophoresis of miRNA real time RT-PCR products. Real time RT-PCR assays were performed with 10 6 copies of synthetic miRNA (a), 10 ng U251 total RNA (b) or non-template control (c). U6 was amplified from 10 pg of U251 total RNA. The amplified products and the 25bp marker (M) were resolved by 4% agarose gel. Product sizes: miR-7 (37bp), miR-21 (38bp), miR-218 (36bp), let-7f (45bp), let-7g (42bp), let-7i (38bp) and U6 (94bp). M miR-7 abc miR-21miR-218let-7flet-7glet-7i U6 100bp 50bp 25bp abcabc abc abcabc Supplemental Fig. 4

8 miR-21 RT OligonucleotideSequence dT CACCGTTTTCTTTCGGTGTCAACA dU CACCGUUUUCUUUCGGTGTCAACA A + Pr – Pr + Pr – Pr BC dTdU Supplemental Fig. 5. UDG treatment of dU-incorporated RT oligonucleotide prevented it from serving as PCR primer after RT. A) Sequence of standard (dT) and dU-incorporated (dU) RT oligonucleotides for miR-21. Synthetic miR-21 (10 9 copies) were reverse transcribed with of dT (B) or dU (C) RT oligonucleotides. The cDNA samples (10% v/v) were then treated with (red amplification curves) or without UDG (blue amplification curves) and subjected to real-time PCR with both forward and reverse primers (+ Pr) or forward primer alone (- Pr). Supplemental Fig. 5 – UDG + UDG – UDG + UDG

9 Phospho-ERK1/2 Total ERK1/2 Phospho-ERK1/2 Total ERK1/2 GDNF (min) U0126 (5 µM) A B Supplemental Fig. 6. GDNF-induced signaling activation in U251 human glioblastoma cells. Control and GDNF stimulated U251 cells were lysed with 2% SDS. Total protein lysates were quantified using microBCA protein assay (Pierce, Rockford, IL, USA). Total protein (10 µg) were separated by SDS-PAGE and probed with antibodies against phospho-ERK1/2 (Cell Signaling Technologies, Danvers, MA, USA). The blots were striped in Western Blot Stripping Buffer (Pierce) and re-probed with total ERK1/2 (Cell Signaling Technologies) to verify equal loading. Chemiluminescence was imaged and analyzed by ChemiDoc system (Bio-Rad). A) Time-course of ERK1/2 MAPK activation by GDNF (100 ng/ml) in U251 cells. B) GDNF-induced ERK1/2 MAPK activation was inhibited by pre-treatment of MEK inhibitor U0126 (5 µM). Supplemental Fig. 6

10 Supplemental Fig. 7. Quantification of GDNF-regulated miRNAs by single-plexed and multiplexed real- time RT-PCR. Total U251 RNA samples were reverse transcribed by single miRNA-specific RT oligonucleotide (black lines) or 24-plexed RT oligonucleotides (red lines). The cDNA samples were then quantified for expressions of (A) miR-218 and (B) let-7i. Regulation of these miRNAs was expressed as fold changes to non-stimulated control samples. Supplemental Fig. 7 Time (min) Fold Change miR-218let-7i AB


Download ppt "Primer Sequence miRNAsCloning (Forward)Cloning (Reverse) miR-7-1TAATACGACTCACTATAGGGTTGGATGTTGCTGTAGAGGCATGGCCTGTGC miR-7-2TAATACGACTCACTATAGGGCTGGATACAGTGCGATGGCTGGCACCATTAG."

Similar presentations


Ads by Google